ID: 956811493

View in Genome Browser
Species Human (GRCh38)
Location 3:72867866-72867888
Sequence GCAAAGGCACGGATGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956811486_956811493 29 Left 956811486 3:72867814-72867836 CCAAGTGGTCCTCCTGAAGGCAA No data
Right 956811493 3:72867866-72867888 GCAAAGGCACGGATGAAGCTTGG No data
956811488_956811493 17 Left 956811488 3:72867826-72867848 CCTGAAGGCAAACTGTGCCTCTG No data
Right 956811493 3:72867866-72867888 GCAAAGGCACGGATGAAGCTTGG No data
956811490_956811493 0 Left 956811490 3:72867843-72867865 CCTCTGGTGTACAGCAGTTGTCT No data
Right 956811493 3:72867866-72867888 GCAAAGGCACGGATGAAGCTTGG No data
956811487_956811493 20 Left 956811487 3:72867823-72867845 CCTCCTGAAGGCAAACTGTGCCT No data
Right 956811493 3:72867866-72867888 GCAAAGGCACGGATGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956811493 Original CRISPR GCAAAGGCACGGATGAAGCT TGG Intergenic
No off target data available for this crispr