ID: 956816892

View in Genome Browser
Species Human (GRCh38)
Location 3:72915883-72915905
Sequence AGGCTGGCCCAGCAGTGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956816892 Original CRISPR AGGCTGGCCCAGCAGTGTCA GGG Intronic
900142860 1:1145786-1145808 TGGCTGACCCAGGAGGGTCAGGG + Intergenic
900149872 1:1173691-1173713 AGGCAGTCCCAGCAGTGACTGGG + Intergenic
900653991 1:3746071-3746093 AGGCAGTCCCAGCATTGGCACGG - Intergenic
901753591 1:11427370-11427392 AGCCTGGACCAGCAGACTCAGGG + Intergenic
901959171 1:12810809-12810831 AGGCTGGGCCAGCAGAGCCTGGG + Intergenic
902194894 1:14791182-14791204 AGGCTGTCCCAGCAGATTAAGGG - Intronic
903226194 1:21895316-21895338 AGACTGGCCCAGCACTGGGATGG - Intronic
903385060 1:22920682-22920704 AGGCTGGCCCAGCATAGGCCAGG + Intergenic
908267999 1:62397221-62397243 AGGCTATCCCAGCACTGCCAAGG + Intergenic
912554809 1:110508300-110508322 GGGGAGGCCCAGCAGAGTCAGGG + Intergenic
913123501 1:115763851-115763873 TGGCTTGCACAGCAGTTTCAAGG + Intronic
915511678 1:156390158-156390180 AGGTTGGACCAGCAGTGCCCTGG - Intergenic
915558430 1:156673077-156673099 AGGCTGGCACAGGTGTCTCAAGG + Exonic
916131031 1:161612004-161612026 AGGATGGCCGAGCAGTCTTAAGG - Intronic
919980543 1:202640274-202640296 AGGCAGAGCCAGCAGGGTCACGG + Intronic
921940578 1:220834616-220834638 GGGCTGGCCAAGAAGTCTCAAGG - Intergenic
922646846 1:227295720-227295742 AGGATGGCCCAGCAGTGAGCTGG - Intronic
922890364 1:229057492-229057514 AGGCTGGACCAGCACTCTCAGGG - Intergenic
923849813 1:237782055-237782077 AGGCTTTCCCAGCAGTGCCACGG - Intronic
923953092 1:238982832-238982854 AGGCTGGCCTGGCACTGACAGGG + Intergenic
1063676388 10:8143856-8143878 TGGCTGGCCCTTCAGTGGCATGG + Intergenic
1064144403 10:12816036-12816058 AGGGTGGCCCAGCAGTGAGGAGG - Intronic
1064160431 10:12940863-12940885 AGGCTTACCCAGCACTGTCCAGG + Intronic
1065493726 10:26308223-26308245 AGGATGGCTCAGCAGGGTCAGGG - Intergenic
1067153257 10:43753540-43753562 AGGCTGGGCCGGCAGTGTGGAGG - Intergenic
1067660618 10:48234086-48234108 GGGCTGGGACAGCAGAGTCATGG + Intronic
1070271633 10:74962098-74962120 AGGCTGGCACAGCACACTCAAGG - Intronic
1075346088 10:121682798-121682820 AGGCAGGCGCAGCTGTGTCCTGG - Intergenic
1077095831 11:798598-798620 GCGCTGGCCCAGCAGTTCCACGG - Exonic
1078362680 11:10681226-10681248 AAGCTGGCCCTGTAGTGTGAGGG + Intronic
1079973478 11:27064225-27064247 AGGATGTCCCAACAGTATCAGGG + Intronic
1081597080 11:44466824-44466846 AGGCAAGCCCAGCGGTGTCTTGG - Intergenic
1081998382 11:47378511-47378533 GTGCTGGCCCTGCAATGTCAAGG - Intronic
1082965568 11:58963475-58963497 AGGCTGCCTCAGCTGTGTCTAGG - Intronic
1084150536 11:67286028-67286050 AGCCAAGCCCCGCAGTGTCAGGG - Exonic
1084414320 11:69022287-69022309 AGGGTGGCCCTGAAGTGTCCGGG - Intergenic
1084644329 11:70445873-70445895 AGGCTGGCGCAGCAGAGGGAGGG + Intergenic
1085085746 11:73665562-73665584 AGGCTGGATCTGCAGTGTGATGG + Intergenic
1088713703 11:112530205-112530227 TGGCTGGCCCAGCTCTTTCAGGG - Intergenic
1089189556 11:116644238-116644260 AGGATGGACCAGCAGTTACAGGG + Intergenic
1090234521 11:125137627-125137649 GGGCAGGCCCACCGGTGTCACGG - Intergenic
1091905921 12:4189053-4189075 TGCCTCGTCCAGCAGTGTCATGG - Intergenic
1096111754 12:49033168-49033190 CAGCTGGCACAGCAGGGTCAGGG - Exonic
1096179040 12:49540551-49540573 AGGCTGGCCCAGAGCTGGCAGGG + Intronic
1096239246 12:49950792-49950814 GGGCTGGCCCAGCTGTCTCAGGG - Exonic
1096558254 12:52417526-52417548 AGATAGGGCCAGCAGTGTCAAGG - Intergenic
1096575260 12:52548818-52548840 TGGCTGTACCAGCAGTGACAGGG - Intronic
1096639680 12:52984200-52984222 AGGGTGGCAATGCAGTGTCAAGG - Intergenic
1097195167 12:57239031-57239053 ACGCTGGCCCAGCGGGGTGAGGG + Intronic
1101009709 12:100436916-100436938 ATGATGGCTCAGTAGTGTCACGG - Intergenic
1102965150 12:117119995-117120017 TGGCTCCCCCAGCAGTGTCCAGG - Intergenic
1103457785 12:121079935-121079957 AAGCTGGCCCACCAGTGACCTGG - Intergenic
1103872122 12:124099581-124099603 AGGCTGGCCCTACAGTATCCAGG + Intronic
1104635530 12:130436003-130436025 AGGCTGACCCAGCAGGGCCGAGG + Intronic
1104996514 12:132661181-132661203 AGGCAAGCACAGCAGTGGCAAGG + Intronic
1105590650 13:21790178-21790200 AGACTGTTCCAGTAGTGTCAAGG + Intergenic
1106591406 13:31101849-31101871 AGGCAGGCCCAGAAGACTCAGGG - Intergenic
1108441356 13:50456446-50456468 AGGGTGGCACAGAGGTGTCAGGG + Intronic
1114716279 14:24828872-24828894 ATGCTGGCCAAGCAATGTAAAGG + Intronic
1117221615 14:53612000-53612022 AGGGTGGCCAAGCAGGGTCTGGG - Intergenic
1118037124 14:61879830-61879852 AGGATTGCCAGGCAGTGTCAAGG - Intergenic
1118132403 14:62981744-62981766 TGGGTGGCACAGCAGTGTAAAGG + Intronic
1122249343 14:100427146-100427168 AGGCTGGCCAGGCAGGGTGAAGG - Intronic
1122529382 14:102415194-102415216 TGGCAGGCTCAGCAGTGACATGG + Intronic
1123438310 15:20271941-20271963 AGGGTGGTCCAGCAGTCTTAGGG - Intergenic
1124890196 15:33725498-33725520 TGGTTGGCCCATCAGTGTCGGGG + Intronic
1128787222 15:70406724-70406746 AGGCTGGCCCAGGAGAGTGGAGG - Intergenic
1129264460 15:74386494-74386516 CTGCTGGCCCAGCAGGGTCCAGG - Intergenic
1129608943 15:77038142-77038164 AGGCAGGCCCAGGACTGTAAGGG + Intergenic
1130367237 15:83251740-83251762 AGGCTCGCCCAGCACTGTGGGGG + Intergenic
1130867474 15:87945027-87945049 TGGCTGGCCCAGCAGAGTCTGGG + Intronic
1132199927 15:99944317-99944339 GGGATGGCCCAGTGGTGTCAAGG + Intergenic
1132348105 15:101120824-101120846 AGGCTGGCCCTGGAGGGTCTTGG - Intergenic
1132856686 16:2048122-2048144 AGGCGGACCCCGCAGTGTCCGGG + Intronic
1133014080 16:2930830-2930852 CGGCAGGCTCAGCAGTGACAGGG - Exonic
1134199865 16:12189020-12189042 AGAGTGGCCCAGAAGTGTCCTGG + Intronic
1136226836 16:28865494-28865516 AGGCTGGCCCAGCCGGGCCCTGG + Intronic
1136569524 16:31088373-31088395 AGCCTGGCTCAGCTGTCTCATGG - Intronic
1139371133 16:66470119-66470141 AGCCTGGACCAACAGTGGCAGGG - Intronic
1139952496 16:70679102-70679124 AGACTGACCCAGCAGTGGCCCGG + Intronic
1141477342 16:84282749-84282771 AGGAAGGCCCTGCAGAGTCAGGG + Intergenic
1142067276 16:88069922-88069944 AGGCTGGCCTTGCTGTCTCAGGG - Intronic
1142283626 16:89161801-89161823 CGGCTGGCCCAGGACGGTCAGGG - Intergenic
1142743079 17:1941882-1941904 AGGCTGGCGCAGCTTTGCCACGG + Intronic
1142993771 17:3749022-3749044 AGGCTGTGGCAGCAGTGTCCAGG + Intronic
1143032607 17:3976346-3976368 AGGCTGGCCCTCCAGGTTCAGGG - Intergenic
1143806762 17:9434931-9434953 AGGCACTCCCAGCAGTGCCATGG - Intronic
1144398230 17:14867042-14867064 AGACTGTCCCAGCATTGACATGG + Intergenic
1144774985 17:17780906-17780928 GGGCAGGCCCAGGAGTGTCCCGG + Intronic
1147167498 17:38601329-38601351 AGGCAGGCCCATCAGAGACATGG + Intronic
1147215010 17:38893916-38893938 AGGCAGGCCCAGAAGGGGCATGG - Intronic
1147685382 17:42283910-42283932 AGGCTGTCCAAGCAGAGGCAAGG + Intergenic
1148124256 17:45228863-45228885 AGACAGGGCCAGCAGTGCCAGGG - Intronic
1148795506 17:50194899-50194921 AGGCTGGGCCTCCAGTGTCAGGG + Intronic
1150463280 17:65370925-65370947 AGCCTGCACCAGCAGAGTCACGG + Intergenic
1152658471 17:81530789-81530811 GGCCTGTCCCAGCAGTGACAGGG + Intronic
1154325456 18:13387601-13387623 AGGCCGGCCCAGCAGAGCGATGG + Exonic
1155239400 18:23851174-23851196 AGGCTGGCCAGGCAGTGTGCAGG + Intronic
1156462210 18:37327455-37327477 AGGCTGGCCCTGCTCTGGCAGGG - Intronic
1157992184 18:52510424-52510446 AGGCAAGGCAAGCAGTGTCATGG - Intronic
1158026074 18:52898865-52898887 AGGCTGTCCCAGCTGGGTGAGGG + Intronic
1158696641 18:59709710-59709732 AGGCTGGACTAGAAGTGACATGG + Intergenic
1159941462 18:74412079-74412101 AGGATGACCCAGCAGGGACAGGG + Intergenic
1160022360 18:75190453-75190475 AGGCTGGCCCTGTCTTGTCATGG + Intergenic
1162743370 19:12785977-12785999 AGGCTTCACCAGCAGTGGCAGGG + Intronic
1163826122 19:19525889-19525911 AGGCTGGCCCTGAAGTGGAAGGG - Intronic
1164704456 19:30310003-30310025 AGGCTGCCCCATCAGAGTCCTGG + Intronic
1166916506 19:46199104-46199126 GGGCTGGGCCAGCAGAGGCAGGG + Intergenic
927135152 2:20091596-20091618 AGCCTGGCCCCGCTGTGTCAGGG - Intergenic
929777756 2:44939217-44939239 GGGCTGGCCGGGCAGTGGCAGGG + Intergenic
931343698 2:61426778-61426800 AGACTGACCCAGCACAGTCATGG + Intronic
932764481 2:74461306-74461328 AGGCTGGTCCAGCCGTGGAAAGG + Exonic
934770864 2:96906992-96907014 AGGCCGGCAAAGCAGTGCCAGGG + Intronic
935175149 2:100642701-100642723 AAGCTGGCCCAGGAGGGTCAGGG - Intergenic
935179078 2:100674268-100674290 TGGCTGGCCCAGCAGTTGCAAGG - Intergenic
936162139 2:110091909-110091931 AGGCTGGCCCCGCTGAGTCACGG + Intronic
936182523 2:110279445-110279467 AGGCTGGCCCCGCTGAGTCACGG - Intergenic
937127979 2:119486336-119486358 AGGCTGGCCCATCTATGTCCAGG + Intronic
937468344 2:122154404-122154426 AGGCAGCCCCAGCAGTGTGGAGG + Intergenic
937853372 2:126655841-126655863 GGCCTGGCCCAGCACTGTCGGGG - Intergenic
938102050 2:128504127-128504149 AGGCTCTCCCAGCAGTGAGAAGG + Intergenic
943424638 2:187715570-187715592 AGGCATTCCCACCAGTGTCATGG + Intergenic
947740584 2:232483077-232483099 AGGCTGGGCAGGCAGGGTCAGGG + Intronic
948098128 2:235352762-235352784 AGGAGGGCCCAGCAGGGTCAGGG + Intergenic
948161743 2:235830218-235830240 AGCCTGGCCCACTGGTGTCATGG - Intronic
1169083974 20:2815729-2815751 AGCCAGGCCAAGCAGGGTCAAGG - Exonic
1170834004 20:19868250-19868272 AGGCTGGGGCAGCAGCGTCTCGG + Intergenic
1173580478 20:44143364-44143386 AGACTCACCCAGCACTGTCAGGG + Intronic
1175943652 20:62549141-62549163 AGGCCGGCTCTGCAGAGTCATGG - Intergenic
1175959100 20:62626092-62626114 AGACTGGCCCTGCAGTGCCTGGG + Intergenic
1178591613 21:33915740-33915762 TGGCTGCCCCAGCAGTGTCCGGG - Exonic
1180126225 21:45792072-45792094 AGGGTGGCCCTGCAGTGGCCTGG - Intronic
1180223562 21:46375707-46375729 ATGCAGGCCCAGCAGTGAGACGG - Intronic
1180259564 21:46659649-46659671 AGGCTTGCCTGGCAGTGGCAGGG + Intronic
1180871051 22:19147676-19147698 AGGGACACCCAGCAGTGTCAGGG + Intergenic
1181505739 22:23355593-23355615 AGTCTTGCTCAGCAGTCTCAGGG + Intergenic
1181553919 22:23656548-23656570 ATTCTGGCCCAGAAGTGTCCTGG - Intergenic
1182357820 22:29730166-29730188 GGGCTGGCCCAGCAGGTACATGG - Exonic
1182426878 22:30278286-30278308 AGGCTGGCTGAGCAGAGTCCAGG + Intergenic
1182896102 22:33860773-33860795 GGACTGGCCCAGGAGGGTCAGGG - Intronic
1183578261 22:38706188-38706210 CGGCTGGCCGAGCAGTCTCCCGG + Intronic
1184158609 22:42684990-42685012 AGGGCTGCCCTGCAGTGTCATGG - Intergenic
1184737956 22:46410164-46410186 TGGCTGGGCCAGCAGTGCCAAGG + Intronic
1185082767 22:48718838-48718860 AGGCTTGCCCTGCAGAGACAGGG + Intronic
1185340871 22:50290543-50290565 CAGCAGGCCCAGCAGGGTCAGGG + Exonic
950683352 3:14600618-14600640 AGCCAGGCCCAGGAGTGACAGGG - Intergenic
952906393 3:38141756-38141778 AAGCTGCCCCAGCAGTGTCGTGG - Exonic
954953049 3:54491884-54491906 AGGCTGGGCCACCAGTGAGAAGG + Intronic
956168638 3:66415301-66415323 GGGGTGGCCCAGCAGCTTCAAGG - Intronic
956816892 3:72915883-72915905 AGGCTGGCCCAGCAGTGTCAGGG + Intronic
957788982 3:84916455-84916477 AGTCTTGCCCACCAGTGACATGG + Intergenic
960522128 3:118667354-118667376 AAGCTGGCCTAGCAGAGACACGG - Intergenic
962943759 3:140148994-140149016 AGGATTGCCCAGCAGGCTCAAGG - Intronic
964420476 3:156496967-156496989 AGGCTGACCCAGTAGTGGCTGGG - Intronic
967123706 3:186406332-186406354 AGGGAGGCCCAGCACTGGCAGGG - Intergenic
968671250 4:1852970-1852992 AGGCTCTCCCAGGAGTGGCAAGG - Intronic
968870111 4:3237647-3237669 ACCCTCGCCCAGCAGTGGCATGG - Intronic
969522951 4:7689360-7689382 AGGCTGGGCCAGGAGTGCCTTGG - Intronic
971372423 4:26029315-26029337 AGGCTGGCCCTGCTGTCCCAAGG + Intergenic
972675039 4:41251905-41251927 AGGCTGGACAAGCAGTTTCTAGG - Intergenic
974145289 4:57938742-57938764 AGCCTAGCCCACAAGTGTCAAGG + Intergenic
976646095 4:87389138-87389160 AGCCTGGACCAGCATGGTCAAGG - Intronic
978987110 4:115026738-115026760 AGGCAGGCACAGCATTGTGAAGG + Intronic
979450521 4:120865371-120865393 AGGCTGACTCAGCAATGGCAAGG - Intronic
979455709 4:120923138-120923160 AGGATGCCCCAGCTGTGTGAAGG - Intergenic
980395741 4:132212880-132212902 ATGCTGGCCCAGGGGTGTTAGGG - Intergenic
982579220 4:157157026-157157048 AATCTCGCCCAGCAGTATCAAGG - Intronic
982804587 4:159748294-159748316 AGGCAGGCCCAGCAGTGATGTGG + Intergenic
984814676 4:183825373-183825395 GGGATGGCCCAGCTGTGTGAAGG - Intergenic
985341128 4:188955768-188955790 AGGCTGGCCCAGCCCTGCCCAGG + Intergenic
985752295 5:1687542-1687564 AGGCTTGCCCTGCAGAGCCAAGG - Intergenic
988526374 5:31990850-31990872 AAGCTGGCCGGGCAGTGTCATGG + Intronic
988734439 5:34006931-34006953 AGGCTGTCACACCAGTGTCAAGG + Intronic
991085932 5:62648395-62648417 AGGCTGTCCCAGCTGTGGCCTGG + Intergenic
991366390 5:65872402-65872424 AGGCAAACCCAGCAGTGTGATGG + Intergenic
994168206 5:96629992-96630014 AGGCAGGCCCAGAAGTGGCCTGG - Intronic
996334884 5:122372411-122372433 AGCCTGGCCCAGTGGTGTAATGG - Intronic
997427953 5:133817047-133817069 AGGTTGGCCCAGGAGTGTTGGGG - Intergenic
997532246 5:134588776-134588798 AGACAGGCCCAGCTGTGTCCTGG - Intergenic
999272564 5:150305300-150305322 AGCCTGGCCTAGCTGTGTAATGG - Intronic
1001285494 5:170420219-170420241 GGGCTGGCCCTGCTGTCTCAGGG - Intronic
1002092368 5:176812886-176812908 AGGCTGGCCCTGCCGTGACCCGG + Intronic
1002640078 5:180626564-180626586 CGGCTGCCCCAGCAGTGACATGG - Intronic
1006399279 6:33807044-33807066 AGACTGGCCCAGCAGAGGCAGGG - Intergenic
1007072563 6:39048245-39048267 AGGCAGGCCCAGGATAGTCAAGG - Intergenic
1007509131 6:42362057-42362079 ACCCAGGGCCAGCAGTGTCAGGG - Intronic
1010005917 6:70994818-70994840 AGGCTGGCCCTACAGAGTCGTGG + Intergenic
1013418952 6:109949065-109949087 ATACTGGCCCAGGAGTGTGAGGG + Intergenic
1015890789 6:137967886-137967908 AGGCTGGGACAGCAGAGTGATGG - Intergenic
1019065014 6:169289040-169289062 AGGCTCACCCAGCAGTGACCAGG - Intergenic
1022500764 7:30881180-30881202 GCGCTGGCCAAGAAGTGTCAGGG + Intronic
1022530382 7:31063246-31063268 GTGCTGGCCAAGAAGTGTCATGG + Exonic
1023868471 7:44250109-44250131 AGCCTGGCCCAGCGTTGTCTTGG - Intronic
1025022224 7:55488852-55488874 AGGCTGTCCGGGCAGTGCCAAGG - Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1028730820 7:94146707-94146729 AGGCAGGCCCAGCAGAGGCAGGG - Intergenic
1032452101 7:132041175-132041197 AGGCTGGAACAACATTGTCAGGG - Intergenic
1035357988 7:158290364-158290386 AGGCTGGCCCTGCAGCTCCATGG - Intronic
1037469417 8:19192981-19193003 AAGCTGGCCCAGGAGAGGCATGG + Intergenic
1038642948 8:29342093-29342115 TGGGTGGCCCAGGAGTGCCAGGG + Intronic
1039890760 8:41683825-41683847 GGCCTGGCCCAGGAGTGGCAGGG + Intronic
1042203373 8:66303820-66303842 AGGCTGGCCCAGCAATCACTTGG - Intergenic
1045011675 8:97964128-97964150 AGTCTGGCCTAGGAGTGGCAGGG + Intronic
1047285924 8:123487185-123487207 AGCCTCGCCCTGCACTGTCAGGG - Intergenic
1049236385 8:141514453-141514475 AGGGTGGCCCTGCAGGGTCCAGG + Intergenic
1049337575 8:142094584-142094606 AGGCTGGCCCAGTGGTGCCAGGG + Intergenic
1049370492 8:142261961-142261983 AGGCTGGCCCCGCCGTGGGATGG - Intronic
1049534206 8:143170550-143170572 AAGCTGGCACAGCAGAGTGACGG + Intergenic
1049640093 8:143711559-143711581 AGGCTGGCCCAGCTGTGGACGGG - Intronic
1049640118 8:143711635-143711657 AGGCTGGCCCAGCTGTGGTGGGG - Intronic
1049640145 8:143711711-143711733 AGGCTGGCCCAGCTGTGGTGGGG - Intronic
1050022265 9:1296555-1296577 TGGCTGGCCCAGCAGGGATAAGG + Intergenic
1051542163 9:18231815-18231837 AGCCTGGCCAAGGAGAGTCAAGG - Intergenic
1052892710 9:33719193-33719215 AGGGCAGCCCAGCAGTGTTAGGG - Intergenic
1057124905 9:92609401-92609423 AGGCTGGAACTGCAGTGACAGGG - Intronic
1057287805 9:93774488-93774510 AGGCTGTCCCACCAGTGCCTCGG + Intergenic
1057755433 9:97831468-97831490 AGACAGGGCCATCAGTGTCAGGG - Intergenic
1060590194 9:124811515-124811537 AGGCTGGCCCAGCAGCCTGGGGG + Exonic
1061084504 9:128391244-128391266 AGGTTGTCCCAGCAGTGTTGGGG + Exonic
1062213139 9:135375263-135375285 CGGCTGGCCCATTAGTGGCAGGG - Intergenic
1062722393 9:138051177-138051199 AGGCCGGGCCAGCAGTGTCTAGG - Intronic
1186125670 X:6411315-6411337 AGGCTGGCCTTGCTGTCTCAAGG + Intergenic
1201466086 Y:14282604-14282626 AGGGAGGCCCACCATTGTCAAGG + Intergenic