ID: 956829982

View in Genome Browser
Species Human (GRCh38)
Location 3:73037131-73037153
Sequence TCGTCTGTGTATTAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956829982 Original CRISPR TCGTCTGTGTATTAAGTGGA GGG (reversed) Intronic
902047332 1:13535574-13535596 TCTTCTGTCTAATAAGTGGCCGG + Intergenic
905876351 1:41434264-41434286 TGGTCTGTGCAGTGAGTGGAGGG - Intergenic
912226922 1:107744310-107744332 TCGACTGTGTAATAAGTGCCTGG - Intronic
915727825 1:158031316-158031338 GCGTGTGTGTGTTTAGTGGAGGG - Intronic
918448013 1:184633711-184633733 TTTTCTGTTTATTCAGTGGAGGG - Intergenic
921539346 1:216394429-216394451 TCTTCTGTGTATTGGTTGGATGG + Intronic
923895956 1:238270247-238270269 TCGTCTATCTATTAAATGTATGG + Intergenic
1067923739 10:50486144-50486166 TAGTTTTTGTATTAAGTGTAAGG - Intronic
1072777706 10:98216566-98216588 TCGTCTGTTTTTTATGTGGTGGG + Intronic
1076943107 10:133623059-133623081 TCGTCTGTGAACCACGTGGATGG + Intergenic
1078006852 11:7538597-7538619 TGGGCTGTGTCTTCAGTGGAAGG + Intronic
1081659737 11:44880702-44880724 TCATCTGTGCATGAAGTGGTTGG + Intronic
1082802176 11:57423187-57423209 TCCTCTGTGTAATGGGTGGAAGG + Intronic
1084035758 11:66509311-66509333 TCGTGTGTGTATTTAGGGGCTGG + Exonic
1085874309 11:80387577-80387599 TTGTCTCTGCATTGAGTGGAAGG - Intergenic
1087798781 11:102481905-102481927 TTGTCTGTATGTTTAGTGGATGG + Intronic
1091065361 11:132505189-132505211 TGATCTGTGTGGTAAGTGGATGG - Intronic
1092482172 12:8869534-8869556 ACGTCTGTATATTAATTGTATGG - Intronic
1094251435 12:28366771-28366793 TCCTCTGTGGTTTCAGTGGATGG + Intronic
1096057138 12:48663559-48663581 TGGTCTTTTTGTTAAGTGGAGGG - Intronic
1099656789 12:85503208-85503230 TCGTATGTGTATTAAATCTAGGG + Intergenic
1101579272 12:106027228-106027250 TCATCTGTGTGTCAAGGGGAGGG + Intergenic
1104309810 12:127644316-127644338 TAAACTGTGTATTTAGTGGAAGG - Intergenic
1112616662 13:101013813-101013835 TCTTCTTTGTATTTAGTGGCAGG - Intergenic
1127180813 15:56415402-56415424 TGGTCTTTGTATAAGGTGGAAGG + Intronic
1133345877 16:5070181-5070203 TCGTCTGTGAATTAAGGGAGGGG - Intronic
1134320235 16:13156042-13156064 TCTGCTGTTTCTTAAGTGGATGG + Intronic
1135346876 16:21696271-21696293 TCCTCTGGGAATTCAGTGGAGGG + Intronic
1141001105 16:80309020-80309042 TGGTATGTGTATTGGGTGGAGGG - Intergenic
1146375667 17:32292515-32292537 TGGTCTGTGTTTATAGTGGAGGG + Intronic
1147437657 17:40427419-40427441 TCCTCTTTGGATTCAGTGGAAGG + Intergenic
1148343460 17:46887890-46887912 TCTTCTGTGTTTTAAGAGCAGGG - Intergenic
1148381971 17:47206450-47206472 GCGTGTGTGTTTTAACTGGAAGG + Intronic
1164410846 19:28003505-28003527 TCGTCTGTGTCTTGGGTGGGAGG - Intergenic
1164515796 19:28934202-28934224 TCGTCTGTGTCTTCGGTGGGAGG - Intergenic
1167615901 19:50533406-50533428 TGGTCTGTGTATTATTTGGGAGG - Intronic
925770121 2:7274055-7274077 TCCTCTGTGTATTACATGAAAGG - Intergenic
926718872 2:15943808-15943830 TTGTCTGTGTCTTAAGCTGAAGG + Intronic
930176612 2:48307382-48307404 TCATCTCTGTACTAAGTGCAGGG + Intergenic
930751684 2:54940552-54940574 TTTGCTGTGTATTAAGTGTAAGG - Intronic
1172788784 20:37487947-37487969 TCTTCGGTGTGGTAAGTGGATGG - Intergenic
1173398562 20:42703656-42703678 TTTTCTGTGTAGTAAATGGAAGG - Intronic
1179039518 21:37789878-37789900 TAGTCTGTGGTTTGAGTGGAAGG + Intronic
1179668360 21:42927934-42927956 TCAATTGTGTATTCAGTGGAAGG - Intergenic
1184535993 22:45087258-45087280 TCGTCTGTTTTTTAAGTGTAGGG - Intergenic
952337044 3:32412570-32412592 TCATCTGGGTCTTAAGTTGAAGG + Intronic
956829982 3:73037131-73037153 TCGTCTGTGTATTAAGTGGAGGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964773669 3:160252564-160252586 TAAACTGTGTATTCAGTGGAAGG - Intronic
969324450 4:6432961-6432983 TTTTCTGTTCATTAAGTGGAAGG - Intronic
971030600 4:22633643-22633665 GTGTGTGTGTATAAAGTGGAAGG + Intergenic
985446460 4:190023501-190023523 TCGTCTGTGAACCACGTGGATGG + Intergenic
987176287 5:15313942-15313964 ATGTCTGAGAATTAAGTGGAAGG - Intergenic
993262457 5:85676288-85676310 TTGTCTGTTTATTGATTGGATGG + Intergenic
995892915 5:116976573-116976595 TCGTCTATGTATTAAATGCCTGG + Intergenic
1004637647 6:17484286-17484308 GCGTCTGTGTATTCAGTGCTTGG + Intronic
1011863779 6:91794559-91794581 TAATCTGGGTACTAAGTGGAAGG - Intergenic
1012312280 6:97740092-97740114 TGGCCTGTGTATTGAGTGAAAGG - Intergenic
1015919324 6:138250972-138250994 GCGTGTGTGTATCTAGTGGAAGG + Intronic
1016260736 6:142167010-142167032 TGGGCTGTGTATTTAGTGAAAGG + Intronic
1018475003 6:164131797-164131819 TCCTCTGTTTATTAGGTGAAGGG - Intergenic
1018492898 6:164314736-164314758 TCATCTGTGTAGTATTTGGAAGG + Intergenic
1021255908 7:18391741-18391763 TTGTCTGTGTACTAAGTGAGGGG - Intronic
1022777113 7:33538359-33538381 TCTTTATTGTATTAAGTGGATGG + Intronic
1028471436 7:91211013-91211035 TTGTATTTGTATTCAGTGGAGGG - Intergenic
1030654473 7:112150977-112150999 TTTTCTGGTTATTAAGTGGAAGG + Intronic
1043774496 8:84247920-84247942 TCTTCTGTGTATTATGTCAAAGG + Intronic
1050681269 9:8114511-8114533 TTGTTTGTGTAGTAAGTGGGTGG + Intergenic
1056422891 9:86446870-86446892 TCGTGTGTGTATGAAGGAGAAGG + Intergenic
1061573109 9:131489798-131489820 TCGTCTGTGTACTGACGGGAAGG - Intronic
1186175309 X:6920420-6920442 TCTTCTGTGCATTCTGTGGAAGG + Intergenic
1187807232 X:23133965-23133987 TATTCTGTGTAATAAATGGATGG - Intergenic
1190486299 X:50928371-50928393 ATGTGTGTGTACTAAGTGGAAGG - Intergenic
1191021851 X:55868753-55868775 TAAATTGTGTATTAAGTGGAAGG - Intergenic
1195049301 X:101082405-101082427 TGGTCTGTTTCTTAAGTGGTAGG - Intronic