ID: 956831220

View in Genome Browser
Species Human (GRCh38)
Location 3:73050501-73050523
Sequence TTGGTTTTCCACCAGTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956831220 Original CRISPR TTGGTTTTCCACCAGTTTGA GGG Intronic
905138159 1:35816922-35816944 TTGGTTTTCCAACAGTTCCAAGG - Exonic
905378146 1:37539080-37539102 CTTGTTTTCCTCCAGCTTGATGG - Intronic
905708382 1:40079909-40079931 TTTGTTTTGAAACAGTTTGAAGG - Intronic
907583938 1:55598676-55598698 TTGGTTTTCTAAAAGTTTTATGG + Intergenic
909336342 1:74479481-74479503 TTGGTTTTCCTCCTGTTGGGTGG - Intronic
910055599 1:83029818-83029840 TTCATGTTCCCCCAGTTTGAGGG - Intergenic
911524349 1:98965780-98965802 TTGAGTTACCACCAGTTAGAGGG - Intronic
913211865 1:116589049-116589071 CTTGTTTTCCACCAGGGTGAGGG + Exonic
913443614 1:118925966-118925988 TTGGCTTTTAATCAGTTTGAGGG + Intronic
915119800 1:153622440-153622462 TTATTTTTCCACCAGTATGTAGG + Intronic
923007400 1:230062087-230062109 TTGATTTTTTACCGGTTTGATGG + Intronic
923653946 1:235899436-235899458 TCACTTTTCCACCAGTTTGGTGG + Intergenic
924540586 1:244977205-244977227 TTGGTTGCCCAGCAGTGTGAAGG + Intronic
1062871321 10:907644-907666 TTGGTTTTCCTCCCATTTCATGG + Intronic
1063722482 10:8598351-8598373 TTGGATTTCCAGCAGGATGAAGG - Intergenic
1066577053 10:36837410-36837432 TTTCTTTTCCTCCACTTTGAAGG - Intergenic
1066707959 10:38201886-38201908 AAGGTTTTACTCCAGTTTGATGG + Intergenic
1066981738 10:42422862-42422884 AAGGTTTTACTCCAGTTTGATGG - Intergenic
1066988762 10:42492430-42492452 TTCCTTTTCCACCAGTTTCATGG + Intergenic
1067785619 10:49243503-49243525 TTGATTTTTCAGCAGTTAGAAGG - Intergenic
1068097839 10:52514195-52514217 TTACTTTTCCACCAGCATGAAGG + Intergenic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1071313348 10:84365609-84365631 TTGTGGTTCCACCAGTTTGTGGG - Intronic
1074101405 10:110357308-110357330 TGGGTTTCCCTCCACTTTGAAGG - Intergenic
1076036773 10:127205200-127205222 TTGGTTCTCTACCATTTTCATGG - Intronic
1078049336 11:7948149-7948171 TTGATTTTCCTGCTGTTTGAAGG - Intergenic
1081006731 11:37753455-37753477 TTTTTTTTCCATCAGTTTCAGGG + Intergenic
1086067014 11:82756383-82756405 TTGGTTTTCTTCCAGTATCATGG - Intergenic
1086596858 11:88582926-88582948 TTTCTTTTCCACCAGTTTTGTGG + Intronic
1086662728 11:89441346-89441368 TTGGTTTTCCAGAAGGTAGAAGG - Intronic
1086733948 11:90283060-90283082 TTGGTTTTCCACAGCTTTGGTGG + Intergenic
1089804019 11:121066444-121066466 TTGGTTTTCTACCAATCAGAAGG + Intronic
1091048288 11:132345086-132345108 TTGGTTTGATCCCAGTTTGATGG - Intergenic
1092501912 12:9056336-9056358 TTGATTTTCCACCAGAGTAACGG - Intergenic
1092514333 12:9192854-9192876 TTGGCTGTCGACCAGTATGAGGG - Intronic
1095643523 12:44513228-44513250 TTGGCTTTACACCAGTTAGGGGG - Intronic
1096127242 12:49128886-49128908 TTGGTTTTCCACAGCTTTGGTGG - Exonic
1096134190 12:49185938-49185960 TTGGTTTTCCACAGCTTTGGTGG - Exonic
1096144945 12:49272283-49272305 TTGGTTTTCCACAGCTTTGGTGG + Exonic
1096894024 12:54801986-54802008 TTTGTTTTTCAGCAGTTTAATGG - Intergenic
1097834385 12:64258704-64258726 TGGGTTTCCCACGAGTTTGCTGG + Intergenic
1098456069 12:70674831-70674853 TGGGTTTTCTCCCAGTGTGATGG + Intronic
1099116352 12:78630012-78630034 GTGTTTTTCCACCAGTATTATGG + Intergenic
1101308365 12:103553909-103553931 TTTCCTTTGCACCAGTTTGAGGG + Intergenic
1102979708 12:117231781-117231803 CTGGTCTTCCACCAGTTCTAAGG - Intronic
1105215119 13:18279675-18279697 CTTGTTTTCCACCAGGGTGAGGG + Intergenic
1105830839 13:24161679-24161701 TTGGTTTTCCTGCACTTGGAGGG - Intronic
1106051056 13:26189941-26189963 TTCATTTTCCACAAATTTGATGG + Intronic
1107673316 13:42769292-42769314 TTTATTTTCCACCATTATGAAGG + Intergenic
1108109468 13:47052672-47052694 TTGCTTCTCCACTAATTTGAAGG - Intergenic
1108549229 13:51526674-51526696 TTGGTTTTCTACTGGTTTTAGGG - Intergenic
1110235358 13:73212165-73212187 TTTTTTTTCCACCTGTTTCAAGG + Intergenic
1111627019 13:90800715-90800737 TAGGCTTTCCACCAGTGTGGAGG - Intergenic
1113266542 13:108624370-108624392 TTGTTCTTCAATCAGTTTGAGGG - Intronic
1114249870 14:20949892-20949914 TAGGTTTTCCATCAATTTGGTGG - Intergenic
1116602909 14:46950008-46950030 TTATTTTTACAGCAGTTTGATGG - Intronic
1119552845 14:75528076-75528098 CTGGTTTACCACCAGTGTCAGGG + Intronic
1120139526 14:80912961-80912983 TTGGTTTTCCAAGAGTTTACAGG + Intronic
1122071020 14:99205372-99205394 CTGGTGCTCCACAAGTTTGACGG + Intronic
1123392221 15:19888428-19888450 TTTGTTTTCCACAAATTTGGGGG + Intergenic
1125249072 15:37678506-37678528 TTAGTTTTCTACCAGTTAGATGG + Intergenic
1125371350 15:38981366-38981388 TTGGTTTTCCATTTGCTTGATGG + Intergenic
1126541574 15:49830125-49830147 TCTGTCTTCCACCAGTTTCATGG - Intergenic
1127379243 15:58415644-58415666 TTTAATTTTCACCAGTTTGATGG - Intronic
1129768417 15:78185268-78185290 TTGGTCTTCCTCCAGCTTCATGG - Intronic
1131638052 15:94258809-94258831 TTTGTTTTCCAACAGGTTAAAGG + Intronic
1132194932 15:99907527-99907549 TTCGTTTTTAATCAGTTTGATGG + Intergenic
1136374678 16:29858614-29858636 GTGCTTTTCCTCCAGTTTGCTGG - Exonic
1143868583 17:9941770-9941792 TCCGTTTCCCACCAGTTTAATGG + Intronic
1145949166 17:28802490-28802512 TTGGGTTACCACCTGGTTGATGG - Intronic
1148428973 17:47626459-47626481 TGGTTGTTCTACCAGTTTGATGG + Intergenic
1149173974 17:53846987-53847009 TAGCTTATCCACAAGTTTGAAGG + Intergenic
1149344269 17:55718355-55718377 TTGCTTTTCAAGCATTTTGAAGG + Intergenic
1149784241 17:59421997-59422019 ATGTTTTCCCACCAGTGTGAGGG + Intergenic
1153199625 18:2635051-2635073 TTGGTCTCCCAGCATTTTGATGG - Intergenic
1153855471 18:9141042-9141064 TTGGTTTTCGAAGAGTTTGAAGG + Intronic
1155656830 18:28202548-28202570 TTGGTTTTCCATCAGTTACTCGG - Intergenic
1159721401 18:71896337-71896359 TTTTTTTTCTACCAGTTTGGGGG + Intergenic
1161612291 19:5250227-5250249 CTGGTTTGCCACGAGTTTAAGGG + Intronic
1162036326 19:7941728-7941750 TCCGTTTTCCCCCAGTTTCAGGG - Intronic
1162142531 19:8593122-8593144 TTGGTTTTCTCCCAGTAAGATGG - Intronic
1165076040 19:33280537-33280559 TTGGTTTTCCAGCAGGTGGCTGG - Intergenic
1166673300 19:44724342-44724364 TTGTCTCCCCACCAGTTTGAGGG + Intergenic
1167968468 19:53168980-53169002 TTGGTTTTCTAAAAGTTTTATGG - Intronic
926013180 2:9424026-9424048 TTGCTTTTTCATCAGTTTCAGGG + Intronic
931694678 2:64862884-64862906 CTGGTTTTCCTCCAGTGTCATGG + Intergenic
934299200 2:91767062-91767084 CTTGTTTTCCACCAGGGTGAGGG - Intergenic
934977131 2:98810600-98810622 TTTTTTTTCCTCCAGTCTGATGG - Intronic
937382759 2:121395724-121395746 CAGGTATTCCATCAGTTTGAAGG + Intronic
937671744 2:124545434-124545456 TAGGTTTTCCAAATGTTTGAGGG - Intronic
938707756 2:133947739-133947761 TTGTTTTTTCACCTTTTTGATGG - Intergenic
943099071 2:183465939-183465961 TTGTTTTTCCATCAGCTTAAAGG + Intergenic
945695364 2:213095385-213095407 TTGGTCAACCACCAGTATGATGG - Intronic
946098107 2:217292849-217292871 TTGCTTTTCCACCAGTGTCTGGG + Intronic
948608418 2:239151410-239151432 TGGGTTTTCCTCCATTTTGGGGG - Intronic
1170295003 20:14814048-14814070 TTGGTTTTCTTCCAGTTTCCTGG - Intronic
1170509473 20:17061628-17061650 TTGTTTTTCAACCAGATTGTAGG + Intergenic
1172464143 20:35143097-35143119 TCTGTTTTCCACAAGGTTGAAGG - Intronic
1172511308 20:35503045-35503067 ATGGTTTTCCTCCAGTTCCAGGG - Exonic
1172998863 20:39091355-39091377 TTGATTTTGCACCTGTTTCAGGG + Intergenic
1174313105 20:49674808-49674830 ATGGCTTTCCACCACTTTCAAGG + Intronic
1174888512 20:54363168-54363190 ATGGTTTTCCAGCATTTGGATGG + Intergenic
1177020375 21:15848335-15848357 TTAGTTTTCCAACAGTATGGAGG + Intronic
1178775927 21:35550692-35550714 TTGATTTTTCACCAGCTTGCTGG - Intronic
1181271801 22:21663261-21663283 ATGATGTTCCACCCGTTTGATGG - Intronic
1184951633 22:47847188-47847210 TTGGTTATCCTCCAGTAGGAAGG + Intergenic
949151538 3:773823-773845 TTGGTTTTGAATCAGTTTCATGG - Intergenic
954646740 3:52136182-52136204 TTGATTTACCACAAGTTTTAAGG - Intronic
956518007 3:70071789-70071811 TAGGTTTTCCAATAGCTTGAAGG + Intergenic
956831220 3:73050501-73050523 TTGGTTTTCCACCAGTTTGAGGG + Intronic
959691147 3:109199635-109199657 TTGTTTTTACACCACTATGATGG + Intergenic
961226379 3:125252181-125252203 TTGGTTTTTCACCTTCTTGATGG + Intronic
964557453 3:157955209-157955231 TGGGTTGTCTCCCAGTTTGAAGG - Intergenic
965129549 3:164679235-164679257 TCCGATTTCCATCAGTTTGATGG + Intergenic
966427238 3:179792517-179792539 TTGGCTTTCCTCCACCTTGACGG - Intergenic
967384927 3:188901900-188901922 CTGAGTTTCCACCAGTTTTAGGG + Intergenic
967635583 3:191798742-191798764 TCGGTTTTGCACCAGTATCATGG - Intergenic
968220178 3:196931729-196931751 TTGTTTGACCACTAGTTTGATGG - Exonic
969949753 4:10823225-10823247 TTTCTTTTCCCCCAGTTTGGGGG + Intergenic
969953390 4:10863882-10863904 TTGTTTTCCCATCAGATTGACGG - Intergenic
974996890 4:69172435-69172457 TTAGTTTTCCACTACTTTGATGG + Intronic
976839314 4:89412673-89412695 TTGTCTTTCCACCATTTAGAAGG - Intergenic
981759143 4:148174322-148174344 TTGGTTTTCCAGGTGTTTTATGG - Intronic
982870213 4:160570086-160570108 TTGTTTTTCCACCACTTTTTAGG + Intergenic
984398694 4:179233290-179233312 TTGTTTTTCCCCCATTGTGATGG + Intergenic
988898865 5:35709511-35709533 CTGGTTTTCCACCAGAATAAGGG + Intronic
989693045 5:44168852-44168874 TTTGTTTTCCATTTGTTTGATGG + Intergenic
990085343 5:51969660-51969682 TTGGTTTTACACAATTTTGGAGG - Intergenic
991396202 5:66207688-66207710 TTGGTCTTCTTCCAGTTTCAGGG - Intergenic
995526101 5:113051849-113051871 TTGGATTTTCACCAGTTTCTAGG - Intronic
996058649 5:119008393-119008415 TTATTTTTCCCCCAGTTTTAAGG - Intergenic
1004496339 6:16166479-16166501 TTGGTTATCCTCCAGTTTCCTGG - Intergenic
1007006941 6:38373014-38373036 TTGGTTTTTCTGCAGTTTGAGGG + Intronic
1007172026 6:39870724-39870746 TTGGTTTTCAAACTGGTTGATGG + Intronic
1011391464 6:86858594-86858616 TTGGTTTTCATTCAGTTTGGGGG - Intergenic
1011675528 6:89729693-89729715 TTTTTTGTACACCAGTTTGAAGG + Intronic
1011758425 6:90530164-90530186 CTGGTCTGCCACCACTTTGAAGG - Intronic
1012227579 6:96722393-96722415 TTGATTTTCCCACACTTTGATGG - Intergenic
1012628692 6:101435520-101435542 TTGTTTTTCTCCCAGTTTGTTGG + Intronic
1013580410 6:111528702-111528724 TTGGTTTTAAACCAGATAGAAGG - Intergenic
1014326346 6:120000281-120000303 TTGGTTTGCAAACAGTTGGAAGG - Intergenic
1014657150 6:124121303-124121325 TTTGTTTTCCAGTAGGTTGATGG + Intronic
1016795979 6:148117890-148117912 TTTGTTTTCCAACATTTTAATGG + Intergenic
1016995732 6:149961430-149961452 TTGGTTTTCAACCAGTCTGGGGG - Intergenic
1017012457 6:150071738-150071760 TTGGTTTTCAACCAGTCTGGGGG + Intergenic
1017434221 6:154400690-154400712 TTGTTTTTCCTCTAGTTTTAGGG - Exonic
1017557488 6:155587639-155587661 ATGGATTTCCACAAGTATGATGG + Intergenic
1020513745 7:9090726-9090748 TTGTTTCTTCCCCAGTTTGAGGG - Intergenic
1024478483 7:49839405-49839427 TTGGTTGTCCTCAAATTTGATGG - Intronic
1024625034 7:51199831-51199853 TAGGCTTTCCACCACTTTGATGG - Intronic
1026451967 7:70537227-70537249 TTTGTTTTACACCAGATTTATGG - Intronic
1027584090 7:80035102-80035124 CTGGTTTTCAAAAAGTTTGAAGG + Intergenic
1028650715 7:93147695-93147717 TTAGTTTTCAACCAGATTGCTGG + Intronic
1028952663 7:96654411-96654433 ATGGTTTTCCAGCATTATGATGG + Intronic
1031404089 7:121362173-121362195 GTTTTTTTCCTCCAGTTTGAAGG - Intronic
1035154474 7:156900909-156900931 TTGTTTTACCACCATTTTTAAGG + Intergenic
1035473081 7:159122985-159123007 TGGGTCTTCCCCCAGTTGGAGGG - Intronic
1036533938 8:9626851-9626873 TTGGTCTTCAACCAGTTTCCTGG + Intronic
1038239015 8:25791111-25791133 TTGGTTTTCCACATGATGGAAGG - Intergenic
1038266337 8:26042189-26042211 TTGGATTTCCTCAAGTTGGAAGG + Exonic
1039082168 8:33744243-33744265 GTGGTTTTCAAACACTTTGAGGG + Intergenic
1042482957 8:69324259-69324281 CTGGTTTTCCTCTAGTTTGAGGG - Intergenic
1042670404 8:71256611-71256633 TTGGTTTTACAACAATGTGAAGG + Intronic
1042919045 8:73903706-73903728 TAGATTTTCCTCCAGTGTGAAGG + Intergenic
1042990022 8:74628938-74628960 ATGGTTTTCCAGTAGTCTGATGG + Intronic
1043753960 8:83978645-83978667 TTTGTTTTTCACCAACTTGACGG - Intergenic
1048338001 8:133517301-133517323 TGAGTTATCCACCAGTTTGGTGG - Intronic
1050052409 9:1616897-1616919 CTGCTTTTCCTCAAGTTTGAGGG + Intergenic
1050744521 9:8859787-8859809 TTAGTTTTCCAGCAATTTGGGGG + Intronic
1051854562 9:21549005-21549027 TTGGTTTCCCACCAGTAAAATGG - Intergenic
1052621985 9:30924232-30924254 TTGGCTTTCAACCTGTTTGCTGG - Intergenic
1055647893 9:78378014-78378036 TCGGTTTTTAACCAGTTTGATGG + Intergenic
1055913654 9:81378366-81378388 TTGGTTTCCCTCCAGTCTAATGG - Intergenic
1057144108 9:92747106-92747128 TTGGTGGGCCACCAGTTTGGTGG - Intronic
1187974097 X:24687796-24687818 CTGGTTTTCCCCCAGTTTAGGGG + Intergenic
1187979744 X:24743348-24743370 TTGGTTTTCTCCCAGTATTAAGG + Intronic
1188128838 X:26405197-26405219 TTGATTTTACAGCTGTTTGAGGG - Intergenic
1188266369 X:28080810-28080832 TTGTTTTTCCACAATTCTGAAGG - Intergenic
1188529354 X:31122076-31122098 TTGATTTTTCACCAGTTTCCAGG + Intronic
1189046897 X:37602836-37602858 TTGGTTTTGTAACATTTTGAAGG + Intronic
1189347814 X:40255493-40255515 TTGATTTTGTGCCAGTTTGATGG + Intergenic
1190724926 X:53182941-53182963 TATGTTTTCCTCCAGTTTTATGG + Intergenic
1193870653 X:86794147-86794169 TATGTTTACCACCAGTTTTATGG + Intronic
1195160962 X:102170925-102170947 TTGGTTTGCCAGCATTTTGTTGG + Intergenic
1195431477 X:104794415-104794437 TTTTTTTTCTACCAGTTTGGTGG + Intronic
1196090000 X:111730295-111730317 TGCTTTTTCCACCAGTTTTATGG - Intronic
1200203227 X:154296607-154296629 TGGTTTTTGCATCAGTTTGAGGG + Intronic
1200894279 Y:8358220-8358242 TTGTTTTTCCACATGTTGGATGG - Intergenic
1202093843 Y:21222959-21222981 TTGCTTTTCTACCACTTTGCAGG - Intergenic