ID: 956833966

View in Genome Browser
Species Human (GRCh38)
Location 3:73080551-73080573
Sequence AATGAGAAGTAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956833966_956833971 25 Left 956833966 3:73080551-73080573 CCCTCCACCTTCTACTTCTCATT No data
Right 956833971 3:73080599-73080621 TGTAATAAGACTTACTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956833966 Original CRISPR AATGAGAAGTAGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr