ID: 956837481

View in Genome Browser
Species Human (GRCh38)
Location 3:73107317-73107339
Sequence CAGGATATGAACCCAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956837478_956837481 5 Left 956837478 3:73107289-73107311 CCTGCGGTCACACAGCCAGTGGC No data
Right 956837481 3:73107317-73107339 CAGGATATGAACCCAGATGCTGG No data
956837476_956837481 6 Left 956837476 3:73107288-73107310 CCCTGCGGTCACACAGCCAGTGG No data
Right 956837481 3:73107317-73107339 CAGGATATGAACCCAGATGCTGG No data
956837480_956837481 -10 Left 956837480 3:73107304-73107326 CCAGTGGCTGAGTCAGGATATGA No data
Right 956837481 3:73107317-73107339 CAGGATATGAACCCAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956837481 Original CRISPR CAGGATATGAACCCAGATGC TGG Intergenic
No off target data available for this crispr