ID: 956838132

View in Genome Browser
Species Human (GRCh38)
Location 3:73112555-73112577
Sequence CAGTGTTGGCCGTTGGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956838132_956838138 10 Left 956838132 3:73112555-73112577 CCTGATTCCAACGGCCAACACTG No data
Right 956838138 3:73112588-73112610 ACCTGAGGATTTTCTGACTCAGG No data
956838132_956838136 -5 Left 956838132 3:73112555-73112577 CCTGATTCCAACGGCCAACACTG No data
Right 956838136 3:73112573-73112595 CACTGGCATCCTTTTACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956838132 Original CRISPR CAGTGTTGGCCGTTGGAATC AGG (reversed) Intergenic
No off target data available for this crispr