ID: 956842120

View in Genome Browser
Species Human (GRCh38)
Location 3:73150306-73150328
Sequence CTAAAGAAACAGGTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956842120_956842127 12 Left 956842120 3:73150306-73150328 CCCAGCCCCACCTGTTTCTTTAG No data
Right 956842127 3:73150341-73150363 TACTCTAGTTGTATAAATATGGG No data
956842120_956842126 11 Left 956842120 3:73150306-73150328 CCCAGCCCCACCTGTTTCTTTAG No data
Right 956842126 3:73150340-73150362 GTACTCTAGTTGTATAAATATGG No data
956842120_956842128 13 Left 956842120 3:73150306-73150328 CCCAGCCCCACCTGTTTCTTTAG No data
Right 956842128 3:73150342-73150364 ACTCTAGTTGTATAAATATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956842120 Original CRISPR CTAAAGAAACAGGTGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr