ID: 956844457

View in Genome Browser
Species Human (GRCh38)
Location 3:73169624-73169646
Sequence CTGTTCTTCTTGTGTACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956844456_956844457 4 Left 956844456 3:73169597-73169619 CCGGGACTCTTAGCAGTTTAAGC No data
Right 956844457 3:73169624-73169646 CTGTTCTTCTTGTGTACAAATGG No data
956844452_956844457 28 Left 956844452 3:73169573-73169595 CCTTTGAGACATCCTGGGTTCAA No data
Right 956844457 3:73169624-73169646 CTGTTCTTCTTGTGTACAAATGG No data
956844455_956844457 16 Left 956844455 3:73169585-73169607 CCTGGGTTCAAACCGGGACTCTT No data
Right 956844457 3:73169624-73169646 CTGTTCTTCTTGTGTACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956844457 Original CRISPR CTGTTCTTCTTGTGTACAAA TGG Intergenic
No off target data available for this crispr