ID: 956844822

View in Genome Browser
Species Human (GRCh38)
Location 3:73172946-73172968
Sequence ATGGGAGACCAGGTATTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956844822_956844828 0 Left 956844822 3:73172946-73172968 CCACCAAATACCTGGTCTCCCAT No data
Right 956844828 3:73172969-73172991 ATAACATACCAAAAGGAAGTTGG No data
956844822_956844825 -7 Left 956844822 3:73172946-73172968 CCACCAAATACCTGGTCTCCCAT No data
Right 956844825 3:73172962-73172984 CTCCCATATAACATACCAAAAGG No data
956844822_956844830 25 Left 956844822 3:73172946-73172968 CCACCAAATACCTGGTCTCCCAT No data
Right 956844830 3:73172994-73173016 CGATTGATCCTCATTATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956844822 Original CRISPR ATGGGAGACCAGGTATTTGG TGG (reversed) Intergenic
No off target data available for this crispr