ID: 956845360

View in Genome Browser
Species Human (GRCh38)
Location 3:73177418-73177440
Sequence CCAGCTAATTACCCAGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956845360_956845365 16 Left 956845360 3:73177418-73177440 CCACTCTCTGGGTAATTAGCTGG No data
Right 956845365 3:73177457-73177479 ATGAGGAATCCACCTTTCAGAGG No data
956845360_956845366 19 Left 956845360 3:73177418-73177440 CCACTCTCTGGGTAATTAGCTGG No data
Right 956845366 3:73177460-73177482 AGGAATCCACCTTTCAGAGGTGG No data
956845360_956845363 -1 Left 956845360 3:73177418-73177440 CCACTCTCTGGGTAATTAGCTGG No data
Right 956845363 3:73177440-73177462 GGATTTGAAAGAGCCTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956845360 Original CRISPR CCAGCTAATTACCCAGAGAG TGG (reversed) Intergenic
No off target data available for this crispr