ID: 956848962

View in Genome Browser
Species Human (GRCh38)
Location 3:73210868-73210890
Sequence CATTAGGAGCAGAGAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956848958_956848962 -7 Left 956848958 3:73210852-73210874 CCGGGTCCTGAGGGAACATTAGG No data
Right 956848962 3:73210868-73210890 CATTAGGAGCAGAGAGAGGCAGG No data
956848957_956848962 -6 Left 956848957 3:73210851-73210873 CCCGGGTCCTGAGGGAACATTAG No data
Right 956848962 3:73210868-73210890 CATTAGGAGCAGAGAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956848962 Original CRISPR CATTAGGAGCAGAGAGAGGC AGG Intergenic
No off target data available for this crispr