ID: 956850689

View in Genome Browser
Species Human (GRCh38)
Location 3:73225548-73225570
Sequence GCTGCATGTAAGTGAAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956850689_956850690 6 Left 956850689 3:73225548-73225570 CCTGGTTTTCACTTACATGCAGC No data
Right 956850690 3:73225577-73225599 TGCTTCAGTGACACCTTTTCAGG No data
956850689_956850692 15 Left 956850689 3:73225548-73225570 CCTGGTTTTCACTTACATGCAGC No data
Right 956850692 3:73225586-73225608 GACACCTTTTCAGGGTTTCCAGG No data
956850689_956850691 7 Left 956850689 3:73225548-73225570 CCTGGTTTTCACTTACATGCAGC No data
Right 956850691 3:73225578-73225600 GCTTCAGTGACACCTTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956850689 Original CRISPR GCTGCATGTAAGTGAAAACC AGG (reversed) Intergenic
No off target data available for this crispr