ID: 956854161

View in Genome Browser
Species Human (GRCh38)
Location 3:73259529-73259551
Sequence GAGGCAGTGCAGATTTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956854161_956854167 14 Left 956854161 3:73259529-73259551 CCTCCAAAAATCTGCACTGCCTC No data
Right 956854167 3:73259566-73259588 AAATCCCTTCTAGCATCCTTTGG No data
956854161_956854170 24 Left 956854161 3:73259529-73259551 CCTCCAAAAATCTGCACTGCCTC No data
Right 956854170 3:73259576-73259598 TAGCATCCTTTGGCCCTAACAGG No data
956854161_956854164 -9 Left 956854161 3:73259529-73259551 CCTCCAAAAATCTGCACTGCCTC No data
Right 956854164 3:73259543-73259565 CACTGCCTCTGGAGACAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956854161 Original CRISPR GAGGCAGTGCAGATTTTTGG AGG (reversed) Intergenic
No off target data available for this crispr