ID: 956854162

View in Genome Browser
Species Human (GRCh38)
Location 3:73259532-73259554
Sequence CCAGAGGCAGTGCAGATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956854162_956854167 11 Left 956854162 3:73259532-73259554 CCAAAAATCTGCACTGCCTCTGG No data
Right 956854167 3:73259566-73259588 AAATCCCTTCTAGCATCCTTTGG No data
956854162_956854170 21 Left 956854162 3:73259532-73259554 CCAAAAATCTGCACTGCCTCTGG No data
Right 956854170 3:73259576-73259598 TAGCATCCTTTGGCCCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956854162 Original CRISPR CCAGAGGCAGTGCAGATTTT TGG (reversed) Intergenic
No off target data available for this crispr