ID: 956854164

View in Genome Browser
Species Human (GRCh38)
Location 3:73259543-73259565
Sequence CACTGCCTCTGGAGACAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956854160_956854164 11 Left 956854160 3:73259509-73259531 CCATCAGATGATGCTAGCTTCCT No data
Right 956854164 3:73259543-73259565 CACTGCCTCTGGAGACAACCTGG No data
956854161_956854164 -9 Left 956854161 3:73259529-73259551 CCTCCAAAAATCTGCACTGCCTC No data
Right 956854164 3:73259543-73259565 CACTGCCTCTGGAGACAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956854164 Original CRISPR CACTGCCTCTGGAGACAACC TGG Intergenic
No off target data available for this crispr