ID: 956854166

View in Genome Browser
Species Human (GRCh38)
Location 3:73259561-73259583
Sequence GGATGCTAGAAGGGATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956854166_956854175 10 Left 956854166 3:73259561-73259583 CCTGGAAATCCCTTCTAGCATCC No data
Right 956854175 3:73259594-73259616 ACAGGAAGACAAAGTTGGCAAGG No data
956854166_956854170 -8 Left 956854166 3:73259561-73259583 CCTGGAAATCCCTTCTAGCATCC No data
Right 956854170 3:73259576-73259598 TAGCATCCTTTGGCCCTAACAGG No data
956854166_956854173 5 Left 956854166 3:73259561-73259583 CCTGGAAATCCCTTCTAGCATCC No data
Right 956854173 3:73259589-73259611 CCCTAACAGGAAGACAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956854166 Original CRISPR GGATGCTAGAAGGGATTTCC AGG (reversed) Intergenic
No off target data available for this crispr