ID: 956854167

View in Genome Browser
Species Human (GRCh38)
Location 3:73259566-73259588
Sequence AAATCCCTTCTAGCATCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956854162_956854167 11 Left 956854162 3:73259532-73259554 CCAAAAATCTGCACTGCCTCTGG No data
Right 956854167 3:73259566-73259588 AAATCCCTTCTAGCATCCTTTGG No data
956854161_956854167 14 Left 956854161 3:73259529-73259551 CCTCCAAAAATCTGCACTGCCTC No data
Right 956854167 3:73259566-73259588 AAATCCCTTCTAGCATCCTTTGG No data
956854165_956854167 -5 Left 956854165 3:73259548-73259570 CCTCTGGAGACAACCTGGAAATC No data
Right 956854167 3:73259566-73259588 AAATCCCTTCTAGCATCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956854167 Original CRISPR AAATCCCTTCTAGCATCCTT TGG Intergenic
No off target data available for this crispr