ID: 956854170

View in Genome Browser
Species Human (GRCh38)
Location 3:73259576-73259598
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956854166_956854170 -8 Left 956854166 3:73259561-73259583 CCTGGAAATCCCTTCTAGCATCC No data
Right 956854170 3:73259576-73259598 TAGCATCCTTTGGCCCTAACAGG No data
956854165_956854170 5 Left 956854165 3:73259548-73259570 CCTCTGGAGACAACCTGGAAATC No data
Right 956854170 3:73259576-73259598 TAGCATCCTTTGGCCCTAACAGG No data
956854161_956854170 24 Left 956854161 3:73259529-73259551 CCTCCAAAAATCTGCACTGCCTC No data
Right 956854170 3:73259576-73259598 TAGCATCCTTTGGCCCTAACAGG No data
956854162_956854170 21 Left 956854162 3:73259532-73259554 CCAAAAATCTGCACTGCCTCTGG No data
Right 956854170 3:73259576-73259598 TAGCATCCTTTGGCCCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type