ID: 956854173

View in Genome Browser
Species Human (GRCh38)
Location 3:73259589-73259611
Sequence CCCTAACAGGAAGACAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956854166_956854173 5 Left 956854166 3:73259561-73259583 CCTGGAAATCCCTTCTAGCATCC No data
Right 956854173 3:73259589-73259611 CCCTAACAGGAAGACAAAGTTGG No data
956854165_956854173 18 Left 956854165 3:73259548-73259570 CCTCTGGAGACAACCTGGAAATC No data
Right 956854173 3:73259589-73259611 CCCTAACAGGAAGACAAAGTTGG No data
956854169_956854173 -5 Left 956854169 3:73259571-73259593 CCTTCTAGCATCCTTTGGCCCTA No data
Right 956854173 3:73259589-73259611 CCCTAACAGGAAGACAAAGTTGG No data
956854168_956854173 -4 Left 956854168 3:73259570-73259592 CCCTTCTAGCATCCTTTGGCCCT No data
Right 956854173 3:73259589-73259611 CCCTAACAGGAAGACAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956854173 Original CRISPR CCCTAACAGGAAGACAAAGT TGG Intergenic
No off target data available for this crispr