ID: 956854175

View in Genome Browser
Species Human (GRCh38)
Location 3:73259594-73259616
Sequence ACAGGAAGACAAAGTTGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956854168_956854175 1 Left 956854168 3:73259570-73259592 CCCTTCTAGCATCCTTTGGCCCT No data
Right 956854175 3:73259594-73259616 ACAGGAAGACAAAGTTGGCAAGG No data
956854165_956854175 23 Left 956854165 3:73259548-73259570 CCTCTGGAGACAACCTGGAAATC No data
Right 956854175 3:73259594-73259616 ACAGGAAGACAAAGTTGGCAAGG No data
956854166_956854175 10 Left 956854166 3:73259561-73259583 CCTGGAAATCCCTTCTAGCATCC No data
Right 956854175 3:73259594-73259616 ACAGGAAGACAAAGTTGGCAAGG No data
956854169_956854175 0 Left 956854169 3:73259571-73259593 CCTTCTAGCATCCTTTGGCCCTA No data
Right 956854175 3:73259594-73259616 ACAGGAAGACAAAGTTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956854175 Original CRISPR ACAGGAAGACAAAGTTGGCA AGG Intergenic
No off target data available for this crispr