ID: 956856782

View in Genome Browser
Species Human (GRCh38)
Location 3:73282951-73282973
Sequence CATAAGGCCCACTCCAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956856782_956856793 12 Left 956856782 3:73282951-73282973 CCACATCTGGAGTGGGCCTTATG No data
Right 956856793 3:73282986-73283008 GGGGGTAGGGGTAGCTGAAGAGG No data
956856782_956856790 -2 Left 956856782 3:73282951-73282973 CCACATCTGGAGTGGGCCTTATG No data
Right 956856790 3:73282972-73282994 TGTGTGAGAGGGTTGGGGGTAGG No data
956856782_956856785 -9 Left 956856782 3:73282951-73282973 CCACATCTGGAGTGGGCCTTATG No data
Right 956856785 3:73282965-73282987 GGCCTTATGTGTGAGAGGGTTGG No data
956856782_956856786 -8 Left 956856782 3:73282951-73282973 CCACATCTGGAGTGGGCCTTATG No data
Right 956856786 3:73282966-73282988 GCCTTATGTGTGAGAGGGTTGGG No data
956856782_956856791 -1 Left 956856782 3:73282951-73282973 CCACATCTGGAGTGGGCCTTATG No data
Right 956856791 3:73282973-73282995 GTGTGAGAGGGTTGGGGGTAGGG No data
956856782_956856794 13 Left 956856782 3:73282951-73282973 CCACATCTGGAGTGGGCCTTATG No data
Right 956856794 3:73282987-73283009 GGGGTAGGGGTAGCTGAAGAGGG No data
956856782_956856789 -6 Left 956856782 3:73282951-73282973 CCACATCTGGAGTGGGCCTTATG No data
Right 956856789 3:73282968-73282990 CTTATGTGTGAGAGGGTTGGGGG No data
956856782_956856792 0 Left 956856782 3:73282951-73282973 CCACATCTGGAGTGGGCCTTATG No data
Right 956856792 3:73282974-73282996 TGTGAGAGGGTTGGGGGTAGGGG No data
956856782_956856795 17 Left 956856782 3:73282951-73282973 CCACATCTGGAGTGGGCCTTATG No data
Right 956856795 3:73282991-73283013 TAGGGGTAGCTGAAGAGGGAAGG No data
956856782_956856788 -7 Left 956856782 3:73282951-73282973 CCACATCTGGAGTGGGCCTTATG No data
Right 956856788 3:73282967-73282989 CCTTATGTGTGAGAGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956856782 Original CRISPR CATAAGGCCCACTCCAGATG TGG (reversed) Intergenic
No off target data available for this crispr