ID: 956857238

View in Genome Browser
Species Human (GRCh38)
Location 3:73287211-73287233
Sequence TACCGCCATCTTTACCAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956857238_956857245 23 Left 956857238 3:73287211-73287233 CCTGATTGGTAAAGATGGCGGTA No data
Right 956857245 3:73287257-73287279 CTGGGAGCATGAAATGAAGTGGG No data
956857238_956857239 4 Left 956857238 3:73287211-73287233 CCTGATTGGTAAAGATGGCGGTA No data
Right 956857239 3:73287238-73287260 TGCCCACCTCAAAGCATTGCTGG No data
956857238_956857246 24 Left 956857238 3:73287211-73287233 CCTGATTGGTAAAGATGGCGGTA No data
Right 956857246 3:73287258-73287280 TGGGAGCATGAAATGAAGTGGGG No data
956857238_956857240 5 Left 956857238 3:73287211-73287233 CCTGATTGGTAAAGATGGCGGTA No data
Right 956857240 3:73287239-73287261 GCCCACCTCAAAGCATTGCTGGG No data
956857238_956857244 22 Left 956857238 3:73287211-73287233 CCTGATTGGTAAAGATGGCGGTA No data
Right 956857244 3:73287256-73287278 GCTGGGAGCATGAAATGAAGTGG No data
956857238_956857247 28 Left 956857238 3:73287211-73287233 CCTGATTGGTAAAGATGGCGGTA No data
Right 956857247 3:73287262-73287284 AGCATGAAATGAAGTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956857238 Original CRISPR TACCGCCATCTTTACCAATC AGG (reversed) Intergenic
No off target data available for this crispr