ID: 956857239

View in Genome Browser
Species Human (GRCh38)
Location 3:73287238-73287260
Sequence TGCCCACCTCAAAGCATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956857235_956857239 15 Left 956857235 3:73287200-73287222 CCAGACTGTTTCCTGATTGGTAA No data
Right 956857239 3:73287238-73287260 TGCCCACCTCAAAGCATTGCTGG No data
956857233_956857239 17 Left 956857233 3:73287198-73287220 CCCCAGACTGTTTCCTGATTGGT No data
Right 956857239 3:73287238-73287260 TGCCCACCTCAAAGCATTGCTGG No data
956857231_956857239 20 Left 956857231 3:73287195-73287217 CCTCCCCAGACTGTTTCCTGATT No data
Right 956857239 3:73287238-73287260 TGCCCACCTCAAAGCATTGCTGG No data
956857238_956857239 4 Left 956857238 3:73287211-73287233 CCTGATTGGTAAAGATGGCGGTA No data
Right 956857239 3:73287238-73287260 TGCCCACCTCAAAGCATTGCTGG No data
956857234_956857239 16 Left 956857234 3:73287199-73287221 CCCAGACTGTTTCCTGATTGGTA No data
Right 956857239 3:73287238-73287260 TGCCCACCTCAAAGCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956857239 Original CRISPR TGCCCACCTCAAAGCATTGC TGG Intergenic
No off target data available for this crispr