ID: 956857241

View in Genome Browser
Species Human (GRCh38)
Location 3:73287240-73287262
Sequence TCCCAGCAATGCTTTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956857241_956857247 -1 Left 956857241 3:73287240-73287262 CCCACCTCAAAGCATTGCTGGGA No data
Right 956857247 3:73287262-73287284 AGCATGAAATGAAGTGGGGCTGG No data
956857241_956857245 -6 Left 956857241 3:73287240-73287262 CCCACCTCAAAGCATTGCTGGGA No data
Right 956857245 3:73287257-73287279 CTGGGAGCATGAAATGAAGTGGG No data
956857241_956857244 -7 Left 956857241 3:73287240-73287262 CCCACCTCAAAGCATTGCTGGGA No data
Right 956857244 3:73287256-73287278 GCTGGGAGCATGAAATGAAGTGG No data
956857241_956857249 18 Left 956857241 3:73287240-73287262 CCCACCTCAAAGCATTGCTGGGA No data
Right 956857249 3:73287281-73287303 CTGGCAGAGAGCACACGGTCTGG No data
956857241_956857246 -5 Left 956857241 3:73287240-73287262 CCCACCTCAAAGCATTGCTGGGA No data
Right 956857246 3:73287258-73287280 TGGGAGCATGAAATGAAGTGGGG No data
956857241_956857252 30 Left 956857241 3:73287240-73287262 CCCACCTCAAAGCATTGCTGGGA No data
Right 956857252 3:73287293-73287315 ACACGGTCTGGAGACTTGTGGGG No data
956857241_956857248 13 Left 956857241 3:73287240-73287262 CCCACCTCAAAGCATTGCTGGGA No data
Right 956857248 3:73287276-73287298 TGGGGCTGGCAGAGAGCACACGG No data
956857241_956857250 28 Left 956857241 3:73287240-73287262 CCCACCTCAAAGCATTGCTGGGA No data
Right 956857250 3:73287291-73287313 GCACACGGTCTGGAGACTTGTGG No data
956857241_956857251 29 Left 956857241 3:73287240-73287262 CCCACCTCAAAGCATTGCTGGGA No data
Right 956857251 3:73287292-73287314 CACACGGTCTGGAGACTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956857241 Original CRISPR TCCCAGCAATGCTTTGAGGT GGG (reversed) Intergenic
No off target data available for this crispr