ID: 956857242

View in Genome Browser
Species Human (GRCh38)
Location 3:73287241-73287263
Sequence CTCCCAGCAATGCTTTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956857242_956857247 -2 Left 956857242 3:73287241-73287263 CCACCTCAAAGCATTGCTGGGAG No data
Right 956857247 3:73287262-73287284 AGCATGAAATGAAGTGGGGCTGG No data
956857242_956857248 12 Left 956857242 3:73287241-73287263 CCACCTCAAAGCATTGCTGGGAG No data
Right 956857248 3:73287276-73287298 TGGGGCTGGCAGAGAGCACACGG No data
956857242_956857245 -7 Left 956857242 3:73287241-73287263 CCACCTCAAAGCATTGCTGGGAG No data
Right 956857245 3:73287257-73287279 CTGGGAGCATGAAATGAAGTGGG No data
956857242_956857251 28 Left 956857242 3:73287241-73287263 CCACCTCAAAGCATTGCTGGGAG No data
Right 956857251 3:73287292-73287314 CACACGGTCTGGAGACTTGTGGG No data
956857242_956857252 29 Left 956857242 3:73287241-73287263 CCACCTCAAAGCATTGCTGGGAG No data
Right 956857252 3:73287293-73287315 ACACGGTCTGGAGACTTGTGGGG No data
956857242_956857244 -8 Left 956857242 3:73287241-73287263 CCACCTCAAAGCATTGCTGGGAG No data
Right 956857244 3:73287256-73287278 GCTGGGAGCATGAAATGAAGTGG No data
956857242_956857246 -6 Left 956857242 3:73287241-73287263 CCACCTCAAAGCATTGCTGGGAG No data
Right 956857246 3:73287258-73287280 TGGGAGCATGAAATGAAGTGGGG No data
956857242_956857250 27 Left 956857242 3:73287241-73287263 CCACCTCAAAGCATTGCTGGGAG No data
Right 956857250 3:73287291-73287313 GCACACGGTCTGGAGACTTGTGG No data
956857242_956857249 17 Left 956857242 3:73287241-73287263 CCACCTCAAAGCATTGCTGGGAG No data
Right 956857249 3:73287281-73287303 CTGGCAGAGAGCACACGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956857242 Original CRISPR CTCCCAGCAATGCTTTGAGG TGG (reversed) Intergenic
No off target data available for this crispr