ID: 956857246

View in Genome Browser
Species Human (GRCh38)
Location 3:73287258-73287280
Sequence TGGGAGCATGAAATGAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956857242_956857246 -6 Left 956857242 3:73287241-73287263 CCACCTCAAAGCATTGCTGGGAG No data
Right 956857246 3:73287258-73287280 TGGGAGCATGAAATGAAGTGGGG No data
956857238_956857246 24 Left 956857238 3:73287211-73287233 CCTGATTGGTAAAGATGGCGGTA No data
Right 956857246 3:73287258-73287280 TGGGAGCATGAAATGAAGTGGGG No data
956857243_956857246 -9 Left 956857243 3:73287244-73287266 CCTCAAAGCATTGCTGGGAGCAT No data
Right 956857246 3:73287258-73287280 TGGGAGCATGAAATGAAGTGGGG No data
956857241_956857246 -5 Left 956857241 3:73287240-73287262 CCCACCTCAAAGCATTGCTGGGA No data
Right 956857246 3:73287258-73287280 TGGGAGCATGAAATGAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956857246 Original CRISPR TGGGAGCATGAAATGAAGTG GGG Intergenic
No off target data available for this crispr