ID: 956867738

View in Genome Browser
Species Human (GRCh38)
Location 3:73386064-73386086
Sequence GTGCAGTAGGACACCTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956867735_956867738 -5 Left 956867735 3:73386046-73386068 CCATCTCAGCTACCTTCAGTGCA 0: 1
1: 0
2: 0
3: 21
4: 279
Right 956867738 3:73386064-73386086 GTGCAGTAGGACACCTGTGTAGG 0: 1
1: 1
2: 1
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956867738 Original CRISPR GTGCAGTAGGACACCTGTGT AGG Intronic
901643588 1:10705189-10705211 GGGCAGTGGGGCACCTGTGGTGG - Intronic
907939214 1:59071191-59071213 GTGCAGTAGGAATCCATTGTAGG + Intergenic
912610803 1:111041405-111041427 GTGCAGCAGGATATATGTGTAGG - Intergenic
914987651 1:152474165-152474187 GTGCAGTAGAAAAGCTGTGGGGG - Intergenic
916102699 1:161406539-161406561 GTGCAGAAGCAGACCCGTGTCGG + Intergenic
919935315 1:202246994-202247016 GTGCAGAAGGGCAGCTGTGAGGG + Intronic
919937552 1:202264640-202264662 GGGCAGAAGGCCACCTTTGTGGG - Intronic
920815058 1:209323513-209323535 GTGCAGGAGTACACATGTGCAGG + Intergenic
921338846 1:214114365-214114387 TTGCAGTAAGACACATGTGGGGG + Intergenic
923051076 1:230391947-230391969 GCCCAGCAGGACTCCTGTGTCGG - Intronic
923781945 1:237032505-237032527 GAATAGTAGGACACCTATGTGGG - Intergenic
1064382541 10:14859213-14859235 GTGCAGGTGGCCACCTGTTTAGG + Intronic
1064749416 10:18511317-18511339 GTGAGGTAGGAAACCTGTGATGG - Intronic
1064928923 10:20602295-20602317 GAGCATTAGGAGACCTGGGTGGG + Intergenic
1066120996 10:32287169-32287191 GTGCAGCAGGACTCGTCTGTTGG + Exonic
1067068606 10:43117180-43117202 GTGCAGTCGCATGCCTGTGTGGG - Intronic
1067529226 10:47058486-47058508 GTGCAGAGGGACACACGTGTGGG + Intergenic
1067729111 10:48796410-48796432 GTGCTGGAAGACACCAGTGTTGG - Exonic
1069587280 10:69616492-69616514 CTGCAGTGGGACAAGTGTGTGGG + Intergenic
1070733324 10:78846670-78846692 GTGCATCAGGATAGCTGTGTTGG - Intergenic
1075428820 10:122363900-122363922 CTACAGCAGGACACCTGTGTTGG + Intergenic
1075672068 10:124269615-124269637 GTGCGGTAGGGCACTTTTGTTGG - Intergenic
1076143776 10:128100185-128100207 CTGACTTAGGACACCTGTGTGGG + Intronic
1077476524 11:2792910-2792932 GTGCACTTTGACACCTATGTGGG - Intronic
1086781026 11:90906129-90906151 GTGCAGTAGGAGAACTGTTTTGG - Intergenic
1086887312 11:92221313-92221335 GTACCCAAGGACACCTGTGTTGG - Intergenic
1088741275 11:112769424-112769446 GTGCAGCTGGACACCAGTGGGGG + Intergenic
1095821740 12:46486205-46486227 GTGCAGAAGTAAATCTGTGTTGG + Intergenic
1096567505 12:52493599-52493621 GTGGAGTAGAAAACCTGTGTGGG - Intergenic
1104360989 12:128132959-128132981 GTGCAGTTGGCCACCTGCTTAGG + Intergenic
1104755565 12:131267120-131267142 GAGCAGAAGGACACTTGTATGGG - Intergenic
1111619254 13:90702556-90702578 GGGCAGAAGGACACCTTTGGAGG - Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1113444504 13:110355365-110355387 CTGCACTAGCTCACCTGTGTGGG + Intronic
1113444621 13:110355884-110355906 CTGCACTAGGTCACCTGTATAGG + Intronic
1118143557 14:63111584-63111606 GTGCCTTAGGACATCTGGGTGGG - Intergenic
1124216657 15:27813004-27813026 GTGCGGTAGGACACTGGTGCAGG - Intronic
1128756583 15:70187535-70187557 GTGGGGGAGGACACGTGTGTGGG + Intergenic
1134026132 16:10955426-10955448 GTGCAGTAGCAAATATGTGTGGG + Intronic
1141191260 16:81826357-81826379 GTGCAGTAGGAGGTCAGTGTAGG + Intronic
1142265392 16:89062027-89062049 GAGCAGCAGGGCCCCTGTGTGGG - Intergenic
1149227370 17:54489765-54489787 GCTAAGAAGGACACCTGTGTGGG + Intergenic
1153441089 18:5120130-5120152 GAGCAGTGGGACAGGTGTGTGGG - Intergenic
1159657940 18:71055299-71055321 GTGCAGCATTACACCCGTGTGGG + Intergenic
1160218415 18:76954664-76954686 CTACAATAGGACACCTGTGTCGG - Intronic
1161151600 19:2713043-2713065 GTGGAGGAGGGGACCTGTGTAGG - Intergenic
1165839423 19:38778984-38779006 TGGGAGGAGGACACCTGTGTGGG + Intergenic
1166149849 19:40864870-40864892 GTGCAGGAGGAGATCTGTGCAGG - Intronic
926411205 2:12604646-12604668 GGGCAGCAGGACACCTGAGGTGG - Intergenic
935629123 2:105197391-105197413 GTGCAGTAAGCCATCTCTGTAGG - Intergenic
940088070 2:149884174-149884196 TTGCAGAAGGACAGTTGTGTAGG + Intergenic
940337488 2:152544465-152544487 GTGCAGAAAAACACCTGTCTGGG - Intronic
940982579 2:160020042-160020064 GTACTGAAGGCCACCTGTGTTGG - Intronic
946570182 2:221015863-221015885 GTGCAGAAAGGTACCTGTGTTGG - Intergenic
947550481 2:231041890-231041912 GTGCAGAAGGAAACCAGTGAGGG + Intronic
948056959 2:235015829-235015851 ATGCAGGAGGACACCTGAGAGGG - Intronic
948427709 2:237898301-237898323 ATGCAGTAGGTCAAATGTGTAGG + Intronic
948853612 2:240720021-240720043 GTGCAGTAGGGCACCTTCGCAGG + Intronic
1170159734 20:13299043-13299065 GTGCTGTAGGCCACCTCAGTGGG - Exonic
1172222163 20:33281513-33281535 GTGCAGGAGGAAGCCTGTGGAGG - Intronic
1172305139 20:33875326-33875348 CTGCAGGAGGAGACCTGTGGGGG + Intergenic
1174274211 20:49391859-49391881 GTGCAGCAGGACACCACTGGAGG - Intronic
1175804596 20:61820539-61820561 GTGCAGTGGGACTGCTGTGAGGG - Intronic
1176266541 20:64212273-64212295 GTGGGGTAGGGCACCTGGGTTGG + Intronic
1176953139 21:15068555-15068577 GTGAACTATGACACCTGAGTAGG + Intergenic
1177181833 21:17752629-17752651 ATGCAGTAGGATCCCTGTGCAGG - Intergenic
1182266126 22:29116891-29116913 ATGCAGTAGGAGTCCAGTGTTGG - Intronic
1184076647 22:42183621-42183643 GCCCAGTAAGACACCTGTGTTGG + Intronic
951847030 3:27095741-27095763 GTCCAGTAAGAAATCTGTGTTGG + Intergenic
952205737 3:31180647-31180669 GTGTAGTAGGGCCCCTGGGTGGG + Intergenic
956867738 3:73386064-73386086 GTGCAGTAGGACACCTGTGTAGG + Intronic
957678597 3:83403715-83403737 ATAGAGTAGGACACCTGGGTCGG - Intergenic
957682962 3:83461539-83461561 GTGTAGTAGCACAGCTGTTTGGG - Intergenic
959323452 3:104906973-104906995 GTGCAGAAGGGGACCTGAGTGGG - Intergenic
964002623 3:151794789-151794811 GTGCCGTAGGACAGCTTTATTGG - Intergenic
965648040 3:170905043-170905065 GTGAAGTAAGACACTTGTCTTGG + Intronic
966077586 3:175956785-175956807 GTGCATCAGGTCACCTGGGTGGG - Intergenic
973119006 4:46494544-46494566 ATACAGTAGGCCACCTGTATTGG - Intergenic
980008461 4:127567950-127567972 GAACAATAGGACATCTGTGTAGG + Intergenic
988321484 5:29703664-29703686 GGGCAGAAGGACAACTGTATTGG - Intergenic
988399864 5:30749371-30749393 CTGCAGTAGCACATGTGTGTTGG - Intergenic
1002304247 5:178273997-178274019 GTGCTGTGGGACACCAGTTTGGG - Intronic
1007808761 6:44471786-44471808 GTGCAGTTGCAGACCGGTGTTGG + Intergenic
1010636026 6:78260280-78260302 GTCCAGTAGGGTATCTGTGTGGG + Intergenic
1013183285 6:107736030-107736052 GTGGAGTAGGCTACTTGTGTGGG + Intronic
1013219012 6:108060063-108060085 GGGCAGTTGGATAGCTGTGTGGG - Intronic
1013931565 6:115540707-115540729 GGGCAGTATGACAGCTGGGTGGG + Intergenic
1014666713 6:124246896-124246918 GCCCAGTGGGACACCTGTGTTGG - Intronic
1019904893 7:4054469-4054491 GTACAGTTTGACACATGTGTAGG + Intronic
1023676081 7:42631675-42631697 GGGCAGTATGAGAACTGTGTGGG + Intergenic
1024594809 7:50923010-50923032 GTGCAGTAGGACAGCTGTGTTGG + Intergenic
1028612282 7:92725197-92725219 GTGCATTAACAAACCTGTGTAGG + Intronic
1029275860 7:99403972-99403994 GTGCAGGAGGTCACCTGTGTGGG - Intronic
1032401547 7:131627754-131627776 AGGCAATAGGCCACCTGTGTAGG - Intergenic
1034474027 7:151272558-151272580 TTGCAGTAGGAGGCCTGTGTGGG + Intronic
1037989998 8:23315015-23315037 GTGCAGTGGGACCCTTGGGTGGG + Intronic
1043468658 8:80539627-80539649 GTGCAGTCTGCCACCTGTTTTGG - Intergenic
1044188013 8:89279704-89279726 GTGCAGTAAGAAACCAGTCTTGG - Intergenic
1045430907 8:102114407-102114429 CTTCAGTAGGACTCCTCTGTAGG - Intronic
1052237151 9:26225131-26225153 GGGCAGGGGGAGACCTGTGTGGG - Intergenic
1058569222 9:106322979-106323001 CTGCATTAGGACCCCTGTGATGG - Intergenic
1059885911 9:118744345-118744367 GTGAAGTTAGACATCTGTGTTGG + Intergenic
1061892456 9:133629978-133630000 GTGCAGTGGGAGCCCTGTGTGGG - Intergenic
1062406252 9:136398006-136398028 GTACAGAAAGACACCAGTGTTGG + Intronic
1189268204 X:39732150-39732172 CTGCGGTAGTACACCAGTGTTGG + Intergenic
1200937224 Y:8748905-8748927 GTGGAATAGGAGACCTCTGTGGG - Intergenic