ID: 956868823

View in Genome Browser
Species Human (GRCh38)
Location 3:73396354-73396376
Sequence CTGCAAACCAGGACCTACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956868823_956868826 -5 Left 956868823 3:73396354-73396376 CCGAGGTAGGTCCTGGTTTGCAG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 956868826 3:73396372-73396394 TGCAGGCATAGTACAAAAAATGG 0: 1
1: 0
2: 2
3: 14
4: 213
956868823_956868830 29 Left 956868823 3:73396354-73396376 CCGAGGTAGGTCCTGGTTTGCAG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 956868830 3:73396406-73396428 ATTACACAGGAAAAGTAATGAGG 0: 1
1: 0
2: 3
3: 28
4: 331
956868823_956868827 16 Left 956868823 3:73396354-73396376 CCGAGGTAGGTCCTGGTTTGCAG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 956868827 3:73396393-73396415 GGCAAAGACCCTGATTACACAGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956868823 Original CRISPR CTGCAAACCAGGACCTACCT CGG (reversed) Intronic
901038663 1:6351209-6351231 ATGCAAACCAGGGCCCACTTAGG + Intronic
901948122 1:12719802-12719824 CTGCAAACCATGAACTGCCCTGG - Intronic
906906086 1:49893760-49893782 CTGCATCTCAGGACCCACCTGGG + Intronic
907893485 1:58659777-58659799 CTGCAAACCAGGGTCCACCACGG - Exonic
908443967 1:64183727-64183749 CTGCACCCCAGAACCTCCCTTGG - Intergenic
910744950 1:90563408-90563430 GTGCAAACTAGCTCCTACCTAGG + Intergenic
911203749 1:95072587-95072609 CAGCAAACCAGCCCCTACCCTGG + Intronic
915891091 1:159774575-159774597 CTGGAAACCAAGCCCTTCCTTGG + Intergenic
917495169 1:175533964-175533986 CTCCAAACCAAGACCTTCCCTGG - Intronic
917550275 1:176019650-176019672 CAGGAAACCAGGACCACCCTGGG + Intronic
918250999 1:182703272-182703294 CTGCAAACCAGAACCTTCCCTGG + Intergenic
920262403 1:204698165-204698187 CTACAACCCAGGAACAACCTAGG + Intergenic
924609536 1:245562445-245562467 CTGAGAACCAGGACCGGCCTCGG + Intronic
1063206438 10:3835995-3836017 CTGCAAAGCAGGAACTTCCATGG - Intergenic
1064009617 10:11725098-11725120 CTGCAATCCTGGACCTCCCAGGG - Intergenic
1066055273 10:31674763-31674785 CTGCAAACCAGGAACCAAATTGG - Intergenic
1066964514 10:42250055-42250077 CTGCTGACAAGCACCTACCTGGG - Intergenic
1067724991 10:48763101-48763123 ATTTAAGCCAGGACCTACCTGGG + Intronic
1069840139 10:71334726-71334748 CTGCACACCCGGACCTGCCTGGG + Intronic
1070669132 10:78365765-78365787 CTGGAGAGCAGGACCTCCCTGGG + Intergenic
1075002843 10:118810654-118810676 CTGCAGACCCAGCCCTACCTAGG + Intergenic
1077959694 11:7062201-7062223 CTACAATCCAGGACATACATGGG - Intronic
1083569241 11:63748231-63748253 CTTTAAACCAGGACCATCCTGGG + Intronic
1087242705 11:95797531-95797553 CTTCAAACCTGAAGCTACCTAGG + Intronic
1088762912 11:112949226-112949248 CTGCTAATAAGGACATACCTGGG + Intergenic
1093464371 12:19435201-19435223 CTGAAAGCCTGGACCTCCCTAGG + Intronic
1096194127 12:49637890-49637912 CTGCAAAACAGGACTTATCAGGG - Exonic
1100798715 12:98209398-98209420 CTGCAACACAGAACCAACCTGGG - Intergenic
1105752878 13:23437668-23437690 CTACAAACCAGGAACTGTCTGGG + Intergenic
1107792503 13:44016319-44016341 TTACAACCCAGGTCCTACCTTGG + Intergenic
1108591470 13:51916635-51916657 CAGGGAACCAGGCCCTACCTGGG - Intergenic
1108809225 13:54200771-54200793 CTCCAACCCAGGATCCACCTGGG - Intergenic
1113463173 13:110495949-110495971 ATAGAAACCAGGACCTTCCTGGG + Intronic
1118798594 14:69168303-69168325 CTACAAGCCAGGCCCTACTTTGG + Intergenic
1121532852 14:94670813-94670835 CTGCAAAACAGGAATTTCCTAGG + Intergenic
1126517556 15:49553533-49553555 CAGCACACCTGGACCTACCAGGG - Intronic
1130429717 15:83834440-83834462 CTGCAAATCAGAATCTAACTTGG - Intronic
1130610741 15:85358733-85358755 CTGCAAACCCAGACAGACCTAGG + Intergenic
1132376413 15:101331196-101331218 CCCCAAACCAGGGCCCACCTTGG + Intronic
1134179628 16:12037064-12037086 CTGGAAACCTGGAGCTACTTGGG - Intronic
1135306368 16:21370833-21370855 CTGGAAACCTGGAGCTACTTGGG - Intergenic
1136303113 16:29349977-29349999 CTGGAAACCTGGAGCTACTTGGG - Intergenic
1136730205 16:32404049-32404071 CTGCTGACAAGCACCTACCTGGG - Intergenic
1139826105 16:69758372-69758394 CTGTAAAACAGTACCTATCTTGG - Intergenic
1140496086 16:75390168-75390190 GGGCCAACCAGGAGCTACCTTGG - Intronic
1141833379 16:86522330-86522352 CTGCAAGCCAGGTGCTTCCTGGG + Intergenic
1202996197 16_KI270728v1_random:113259-113281 CTGCTGACAAGCACCTACCTGGG + Intergenic
1203022884 16_KI270728v1_random:425601-425623 CTGCTGACAAGCACCTACCTGGG + Intergenic
1143043372 17:4056391-4056413 CTGCTAACCAGTACTTTCCTTGG - Intronic
1143516240 17:7420580-7420602 CTGCCGGCCAGGGCCTACCTGGG + Intronic
1143801812 17:9389237-9389259 CTGCAGACCAGGCACTACCAAGG + Intronic
1144324430 17:14164950-14164972 GGGCAAACCAGGACTGACCTAGG - Intronic
1145984356 17:29035111-29035133 TAGGAAACCAGGACCTAGCTAGG - Intronic
1150365353 17:64578020-64578042 CTGCAAACCTCCACCTCCCTGGG + Intronic
1152242476 17:79167744-79167766 CTTCAACCCTGGCCCTACCTGGG + Intronic
1152608611 17:81305006-81305028 CTGCTCACCTGGACCTACCGTGG - Intergenic
1155652755 18:28160791-28160813 CTGCAAACCAAAACCCAACTGGG + Intronic
1157243552 18:46033782-46033804 CTGCAAGCCAGGACATGCCAAGG + Intronic
1158704356 18:59778286-59778308 GTGCAAACCAGGACAGTCCTGGG + Intergenic
1163768381 19:19176238-19176260 CTGCCTCCCAGGACCTGCCTAGG - Intronic
1164157410 19:22604975-22604997 CTCCAAACCATGACCCACCCAGG - Intergenic
1166580339 19:43893095-43893117 CTGCAAACGAGGGGTTACCTGGG + Intronic
925474577 2:4198507-4198529 CTCAAACCCAGGACCTTCCTGGG - Intergenic
928060289 2:28105457-28105479 CTGCAATCCAGTAGCTCCCTAGG - Intronic
929781525 2:44960372-44960394 CTGCAAACCCAGGCCTACCCTGG + Intergenic
933749050 2:85591470-85591492 CTGGAAGCCGGGACTTACCTAGG + Intronic
934186509 2:89682103-89682125 CTGCTGACAAGCACCTACCTGGG - Intergenic
934315507 2:91915127-91915149 CTGCTGACAAGCACCTACCTGGG + Intergenic
935706880 2:105864640-105864662 ATGTAATCCAGGGCCTACCTCGG + Intronic
936031247 2:109072456-109072478 TTGAAAACCAGGACCTTCTTTGG - Intergenic
938322462 2:130374218-130374240 CAGCAAATCAGGACCTATCTAGG + Exonic
945638610 2:212393112-212393134 CTCCAAACCTGAACCTACTTGGG + Intronic
1169444205 20:5657836-5657858 CTGCAAATCAGGGCTGACCTTGG + Intergenic
1170981957 20:21222451-21222473 CTTCAAAACAGGACCTACAAGGG - Intronic
1172175131 20:32967579-32967601 CTCCCACCCAGGCCCTACCTGGG + Intergenic
1174557118 20:51403728-51403750 CTGCAAGCCAGGACCTAAGCAGG + Intronic
1175339025 20:58215843-58215865 CTGCAAGCCCAGCCCTACCTGGG + Intergenic
1180542279 22:16461012-16461034 CTGCTGACAAGCACCTACCTGGG + Intergenic
1183338696 22:37266149-37266171 CTGCAAATCAGGGCTCACCTTGG + Intergenic
1184090918 22:42292678-42292700 CTGCAAAGCAGCACACACCTGGG + Intronic
1184171168 22:42760748-42760770 CTGCAAACAGGTACGTACCTGGG + Intergenic
950447293 3:13045646-13045668 CTGCATACCAGAACTTTCCTGGG + Intronic
953235647 3:41103921-41103943 CTGCATCCCAGGACCCACCAAGG + Intergenic
953751536 3:45612041-45612063 CTGCAAACCATGACAGAGCTGGG - Intronic
954149256 3:48649076-48649098 CTGCAACCTAAGACCTTCCTTGG - Intronic
955098597 3:55824385-55824407 CTGTTAACCTGGACCTTCCTTGG + Intronic
955761103 3:62283620-62283642 CTGCTGACCAAGAGCTACCTTGG - Intronic
956868823 3:73396354-73396376 CTGCAAACCAGGACCTACCTCGG - Intronic
957446525 3:80318928-80318950 CTACAAACTAGGAAATACCTGGG + Intergenic
959307224 3:104683720-104683742 CAGGAATCCAGGACCAACCTGGG - Intergenic
962293831 3:134162026-134162048 CTGCAAACCAAGACACACCAGGG - Intronic
964307711 3:155358528-155358550 CTACAAATCAGGCCCTCCCTTGG - Intergenic
967647485 3:191943917-191943939 CTGCAATACAGGGCCTAGCTAGG + Intergenic
969495518 4:7523977-7523999 CTGAAAACCAGGAGCTCCCCAGG + Intronic
970185998 4:13454734-13454756 CTGCAAACCAGACCCTAAGTTGG - Intronic
970224216 4:13840495-13840517 CTGCAAACCAAGCCCACCCTCGG + Intergenic
975208239 4:71668690-71668712 CTGGAAACCATGAGCTGCCTGGG + Intergenic
977947749 4:102933202-102933224 CTGCTGACAAGCACCTACCTGGG + Intronic
979113424 4:116788928-116788950 CTGCAAACCACAACTTAGCTGGG - Intergenic
989152000 5:38308816-38308838 ATGCAAACCAGGGCGTATCTTGG - Intronic
991512359 5:67393698-67393720 CTGCAAACCAGAACCCAGTTTGG + Intergenic
991769313 5:70025709-70025731 CTCCAAACAAGGACCCTCCTGGG - Intronic
991848608 5:70901127-70901149 CTCCAAACAAGGACCCTCCTGGG - Intronic
992887776 5:81176195-81176217 CTGCAAACCACCACCTAAATGGG + Intronic
992905926 5:81345626-81345648 GTACAAACCAGGTCCTACTTGGG + Intronic
996887620 5:128376755-128376777 CTGCAAACCAGGATTTGTCTTGG - Exonic
997459799 5:134044200-134044222 CTGCCAATCATAACCTACCTTGG - Intergenic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
998350128 5:141494985-141495007 CCGCACACCAAGACCTCCCTGGG - Intronic
999176220 5:149633371-149633393 CTGTAACCCAGGATCTACCTTGG + Exonic
1001643853 5:173265457-173265479 CTCCAAACCTTGACCTCCCTGGG + Intergenic
1004074975 6:12336823-12336845 ACTCAAACCAGGAGCTACCTAGG - Intergenic
1006942081 6:37759133-37759155 CTGCATCCCGGGGCCTACCTCGG + Intergenic
1007061568 6:38945623-38945645 CTGCAAACCCAAACATACCTGGG + Intronic
1010929987 6:81790150-81790172 CTCCAAACCAGTTTCTACCTTGG - Intergenic
1011460289 6:87596047-87596069 CTGGAATTCAGGACCAACCTGGG - Intronic
1014051937 6:116964796-116964818 CAGCAAACCCTGCCCTACCTGGG - Intergenic
1018617616 6:165702881-165702903 CTGGAAGCCAGGACCTGCCGTGG + Intronic
1018997980 6:168724756-168724778 CAGGAAACCAGCACCCACCTGGG + Intergenic
1020212428 7:6166647-6166669 CTGCAAACCAGGCCCCAACAGGG - Intronic
1023089278 7:36602837-36602859 CTGCTCACCAGGACTGACCTGGG + Intronic
1024246648 7:47475813-47475835 CTGCAAACCTGCAACTACCAAGG + Intronic
1029582714 7:101447988-101448010 GTGCAAACTAGGACCTGCCTCGG - Intronic
1030957555 7:115873619-115873641 CTGCAAACCAGGAACTTCTTTGG - Intergenic
1034165645 7:149023075-149023097 CTCCACACCAGGAACTCCCTAGG + Intronic
1039684718 8:39786136-39786158 CTAGAAACCAGGAACTACCGGGG + Intronic
1040540501 8:48349268-48349290 CTGCAAACCAGAATATATCTGGG + Intergenic
1040825707 8:51618608-51618630 CTGCAAACCTGCTCCTCCCTGGG - Intronic
1044432370 8:92123491-92123513 CTGAAATCCAGGACCTACCAAGG - Intergenic
1044869876 8:96608140-96608162 GTGCAAACCATGAACTACATGGG + Intronic
1045062962 8:98424529-98424551 CTGCAGACCAGGCTCTGCCTGGG - Intronic
1047090514 8:121569457-121569479 CTAAAAACCAGGTCCTACATAGG + Intergenic
1047368469 8:124234737-124234759 AGGCACACCAAGACCTACCTAGG + Intergenic
1048475335 8:134737633-134737655 CTGCAACCCCTGACCTAGCTGGG - Intergenic
1048498465 8:134955333-134955355 CTGCAAACCAGGCCATTCCCAGG + Intergenic
1049162396 8:141105725-141105747 CTGGATTCCAGGACCTGCCTTGG - Intergenic
1054250333 9:62711062-62711084 CTGCAAACCAGGATATGCCTAGG - Intergenic
1054564441 9:66745590-66745612 CTGCAAACCAGGATATGCCTAGG - Intergenic
1059365228 9:113781584-113781606 CTGTATAGCAGGACCTTCCTGGG - Intergenic
1060529451 9:124339827-124339849 CTGCAGACCAGGCCCCACGTGGG - Intronic
1061287815 9:129634183-129634205 GTTCAAGCCAAGACCTACCTGGG + Exonic
1061443506 9:130623707-130623729 CTGCAGAGCTGGACCCACCTGGG - Exonic
1062621902 9:137426605-137426627 CTGCAGACCAGGCCATGCCTCGG + Intronic
1192443297 X:71191130-71191152 CTGCAAACCAGAAAATCCCTTGG + Intergenic
1193344474 X:80388795-80388817 CAGCACACCGGGACCTGCCTAGG + Intronic
1200161248 X:154010908-154010930 CTGCAAGCCAGGCCATCCCTGGG - Exonic
1201183172 Y:11369949-11369971 CTGCTGACAAGCACCTACCTGGG + Intergenic