ID: 956870536

View in Genome Browser
Species Human (GRCh38)
Location 3:73412913-73412935
Sequence GACCCCCATGTGTCTCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956870536_956870539 17 Left 956870536 3:73412913-73412935 CCAGGGTGAGACACATGGGGGTC 0: 1
1: 0
2: 1
3: 13
4: 131
Right 956870539 3:73412953-73412975 ATTTATCAGATGTGTGACTTTGG 0: 1
1: 5
2: 54
3: 360
4: 1619
956870536_956870540 18 Left 956870536 3:73412913-73412935 CCAGGGTGAGACACATGGGGGTC 0: 1
1: 0
2: 1
3: 13
4: 131
Right 956870540 3:73412954-73412976 TTTATCAGATGTGTGACTTTGGG 0: 1
1: 1
2: 58
3: 355
4: 1661

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956870536 Original CRISPR GACCCCCATGTGTCTCACCC TGG (reversed) Intronic
900503455 1:3017688-3017710 GACCCCTGTGGGTCTCACACGGG + Intergenic
900557546 1:3287911-3287933 CACCCTCAGGTTTCTCACCCCGG + Intronic
900567193 1:3339316-3339338 GCCCACCCTGTGCCTCACCCTGG - Intronic
903033200 1:20477710-20477732 GGCCCCCATTTGTCTCCCCCAGG - Intergenic
904311996 1:29635031-29635053 GAGCCACATGTGGCTCACCGTGG + Intergenic
905778419 1:40686329-40686351 GACTCCCATGTGTCACACCTGGG - Intergenic
907457211 1:54583312-54583334 GACCCCCATGTGGTACAGCCAGG - Intronic
912041541 1:105397318-105397340 TACCCCAAACTGTCTCACCCTGG + Intergenic
912693418 1:111821714-111821736 CAGCCAGATGTGTCTCACCCTGG + Intronic
912848815 1:113103649-113103671 GACCCCCAGACCTCTCACCCAGG + Intronic
920149491 1:203893055-203893077 GACTCCCCTGTGTTCCACCCAGG - Intergenic
920206000 1:204292589-204292611 GCCCCCCATTTCCCTCACCCTGG + Intronic
1064117459 10:12591133-12591155 GACCCCTCTGTGTCTAACACGGG - Intronic
1070357814 10:75657724-75657746 GCCCCCCAACTCTCTCACCCTGG - Intronic
1076618918 10:131774661-131774683 GCCTCCCATGTGTCTGACCCCGG - Intergenic
1076746517 10:132517410-132517432 AGCCCCCATGTGACTCAGCCAGG - Intergenic
1076767561 10:132644833-132644855 GCCTCACATGTGTCCCACCCAGG + Intronic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077296121 11:1827039-1827061 GGCCGCCATGTGTCCCAGCCCGG + Intergenic
1077372972 11:2192309-2192331 GACCCCCTCGGGTCTCAGCCTGG - Intergenic
1077619423 11:3706889-3706911 GACCACCATTTGTTTCACCATGG - Intronic
1077740767 11:4843018-4843040 TGACCCCATGTCTCTCACCCAGG + Intronic
1079260616 11:18875844-18875866 GACTCCCATGCTTCTCACCAAGG - Intergenic
1080773868 11:35367395-35367417 GACCCTCATGTGTCTAACACAGG + Intronic
1084596537 11:70120089-70120111 GAGCCCCACGTGCCTGACCCTGG + Intronic
1085251923 11:75149648-75149670 GACCCTCATGGGTTTGACCCAGG - Intronic
1085795686 11:79537560-79537582 GATCCCCATCAGTCTCCCCCTGG + Intergenic
1086405382 11:86494773-86494795 GACCCTCATTTGTCTCCCTCAGG + Intronic
1088760411 11:112924036-112924058 CACCCTCCTCTGTCTCACCCAGG - Intergenic
1090930375 11:131292645-131292667 GACCCCCATTTGTTCCATCCAGG + Intergenic
1094677270 12:32633133-32633155 GACTCCTATGTGTCTGACACAGG + Intronic
1097012508 12:55963330-55963352 GACCTCCATCTGCCCCACCCAGG + Intronic
1099152102 12:79126989-79127011 GACTCCCAAGTGTCTCTTCCTGG - Intronic
1100614543 12:96220945-96220967 CACCTCCATGTGTCTCATTCTGG + Intronic
1107957764 13:45532996-45533018 AACCCCCGTGTGTCTCACAAAGG - Intronic
1113718027 13:112528030-112528052 GACCCCTGTGTGGCTCCCCCAGG + Intronic
1114530163 14:23390446-23390468 GAGCCCTTTGTGTCTGACCCAGG - Exonic
1115871178 14:37804465-37804487 TACCCTCATGAGTCCCACCCAGG - Intronic
1118643458 14:67815717-67815739 GAACCACATGTCTCTCACCCTGG + Intronic
1118761387 14:68882353-68882375 GTCCTCCATGGGTCCCACCCAGG + Intronic
1122091328 14:99342904-99342926 GAACCCCATCAGTGTCACCCAGG - Intergenic
1122574248 14:102731802-102731824 GGCCTCCATGTGTCTGACTCGGG - Intergenic
1122792040 14:104188086-104188108 GAAGCCCATGTGCCTCACCGAGG + Intergenic
1126109034 15:45165072-45165094 GACCAGGATGTGTCTCAGCCTGG + Exonic
1128556703 15:68636571-68636593 GCCCCTCATTTTTCTCACCCAGG - Intronic
1129515035 15:76152189-76152211 CACCCCCATGTGCCTTGCCCTGG + Intronic
1135547773 16:23377382-23377404 GGCCCCCAACTGTCTCACCTCGG - Exonic
1140999203 16:80291855-80291877 AACCCACATGTGTCCCAGCCTGG + Intergenic
1141663449 16:85453798-85453820 GACCCCCAGGTGTCTGACCTCGG + Intergenic
1142969588 17:3602261-3602283 GAGCCGTATGTATCTCACCCTGG - Intergenic
1143615853 17:8048659-8048681 GGCCCCCATGTGCCTCTCCTGGG + Exonic
1144305510 17:13966326-13966348 TACCCCAAGCTGTCTCACCCCGG + Intergenic
1146894971 17:36534590-36534612 GACCCTCTTGTGTCTCACGAGGG - Intronic
1147759498 17:42788214-42788236 GTGCCCCAGGTGTCTCACCCTGG - Intronic
1150549329 17:66194619-66194641 AGCACCCATGTGACTCACCCTGG + Intergenic
1151466611 17:74289732-74289754 GACCCCGCTGCTTCTCACCCAGG - Exonic
1152672437 17:81617097-81617119 GGCCCCCATGTCTCACAGCCCGG + Intronic
1154186558 18:12190115-12190137 GACTCCCAGGTCTTTCACCCTGG - Intergenic
1160386743 18:78501510-78501532 CACCCCCAAGTGCCTCACCAGGG + Intergenic
1164121403 19:22268719-22268741 GACAGCCTGGTGTCTCACCCTGG - Intergenic
1164892600 19:31837626-31837648 GACCTCCATGTGCCTTCCCCAGG + Intergenic
1166314573 19:41981873-41981895 GGCCCCCATGGTCCTCACCCGGG + Intronic
1166689723 19:44815117-44815139 GAAGCCCAGGTGTCTCACCATGG + Intronic
1167594040 19:50418226-50418248 GGCCCCCAGGTGTCTGGCCCCGG + Intronic
1167759538 19:51436816-51436838 TATCCCTATGTGTCTCACCATGG - Intergenic
1168294996 19:55373933-55373955 TAGCCCAATGTGTCCCACCCTGG - Intergenic
925390724 2:3492135-3492157 GACCCTCATCTGTGACACCCTGG + Intergenic
927844993 2:26466851-26466873 GACCCACATTTGTCTTGCCCAGG - Exonic
928453376 2:31398481-31398503 GTCCCTCATGCTTCTCACCCTGG + Intronic
931747014 2:65299540-65299562 GACCCTCAAGTGTCTCACCCCGG + Intergenic
934992774 2:98933147-98933169 GTCCCCGCTGTGGCTCACCCTGG + Intronic
938930676 2:136084064-136084086 GACTGCCATGTGTCTCATCTAGG - Intergenic
948579064 2:238971792-238971814 AACCCCCATGTCTCTGAGCCCGG + Intergenic
1171544697 20:25991153-25991175 GACCCCTATGGGTCCAACCCTGG + Intergenic
1176364832 21:6026526-6026548 CAGCCCCCTGTGCCTCACCCCGG + Intergenic
1179758686 21:43512019-43512041 CAGCCCCCTGTGCCTCACCCCGG - Intergenic
1180107493 21:45629724-45629746 CCACCCCACGTGTCTCACCCGGG + Intergenic
1181903679 22:26175981-26176003 CACCCCCATGTGTTTCTTCCTGG + Intronic
1184724050 22:46332724-46332746 GAGGCCCCTGTGTATCACCCAGG - Intronic
1185277240 22:49955068-49955090 CTCCCCCGTGGGTCTCACCCAGG - Intergenic
1185379578 22:50502262-50502284 GACCTCCATCTGGCCCACCCAGG - Intergenic
950304043 3:11904805-11904827 GACCCTTCTGTGTCTCACACTGG + Intergenic
950561921 3:13735841-13735863 GACCCCCATGTCTCCCAGCAGGG - Intergenic
951417487 3:22442758-22442780 GAAACTCATGTGTCTCAACCTGG - Intergenic
951625950 3:24663252-24663274 GAGCCCCATGGGCCTCCCCCAGG - Intergenic
953739693 3:45526996-45527018 GACCCACTTGTGTCTCTACCTGG - Intronic
954610997 3:51944498-51944520 GACCACTTTGTGTCTCACCCGGG + Exonic
956846904 3:73192228-73192250 AACCCCCAGGTGTCTCACTGTGG + Intergenic
956870536 3:73412913-73412935 GACCCCCATGTGTCTCACCCTGG - Intronic
961343228 3:126244360-126244382 TACCCCAATCTGTCTCACCCTGG + Intergenic
968433005 4:569907-569929 CACCCCCATGTGTCACCCTCAGG - Intergenic
968551266 4:1224684-1224706 CACACCCATGGGTCTCACACTGG - Intronic
979300459 4:119080660-119080682 GACCCCCAGGACTCTCACCTAGG - Intergenic
980354517 4:131724829-131724851 GACCCCTATGGGTCCGACCCTGG + Intergenic
985130888 4:186737576-186737598 CTCCTCCATGTGTCTCTCCCCGG - Intergenic
985281051 4:188285628-188285650 GAACCTCATGTGTCTCATCAAGG + Intergenic
985480870 5:109473-109495 CACCCCCAGGTGCCACACCCTGG + Intergenic
985589645 5:757869-757891 GGCCCCCATGTGAGTCCCCCAGG - Intronic
985650905 5:1107058-1107080 TACCCCCATGTGTAACACACGGG + Intronic
986409741 5:7465283-7465305 CACTCCCAGGTGTCTGACCCAGG - Intronic
986426274 5:7635062-7635084 GACCCCTATGTTTCTCAAACAGG - Intronic
990869364 5:60415055-60415077 GACTTCCAGTTGTCTCACCCAGG - Intronic
992397638 5:76382319-76382341 GTCCCCCTTGTGTCTCTCCAGGG + Intergenic
992401076 5:76411961-76411983 GCCCCCCATGTGCCACCCCCAGG - Intronic
994247413 5:97495491-97495513 GAGCCCCATGTGGCTGACCTGGG + Intergenic
994292939 5:98051196-98051218 CACAACCATGGGTCTCACCCAGG - Intergenic
994908390 5:105869197-105869219 AACCCCCTTGAGTCTAACCCAGG - Intergenic
998132106 5:139656388-139656410 GATCCCCAGGTCTCTCACACAGG + Intronic
999360709 5:150984320-150984342 CTCCCTCATGTGTCTCATCCAGG - Intergenic
1000350198 5:160346904-160346926 GACCTCCAAGTGGCTCACCAAGG + Intergenic
1000771391 5:165358896-165358918 TACCCCCATGTCACTCACTCTGG - Intergenic
1001744694 5:174083225-174083247 GACTCCCATGTGCCTGGCCCAGG + Intronic
1001853176 5:174987225-174987247 TTCCACCATGTGCCTCACCCAGG - Intergenic
1002334071 5:178466062-178466084 GACCCCCATGAATCTCATCTTGG + Intronic
1002950410 6:1804372-1804394 GATGCCCATGTGGCGCACCCCGG + Intronic
1003499355 6:6691620-6691642 GACCCCCATGTCACCCACCGCGG + Intergenic
1003625550 6:7738263-7738285 AACCCCCTTGTGTCAGACCCAGG + Intronic
1006828873 6:36956843-36956865 AACCCCCACCTGCCTCACCCTGG - Intronic
1007232320 6:40356801-40356823 GTCCCCCATGAGTCTTCCCCAGG - Intergenic
1007784945 6:44274475-44274497 GACCCCAATATGTCTCATCCTGG - Intronic
1007787691 6:44290692-44290714 GACACCCATGGGCCACACCCAGG + Intronic
1010754486 6:79651647-79651669 CACCCCCATGGGTCTCAGTCAGG - Intronic
1014067340 6:117143207-117143229 GTCCTCCATATTTCTCACCCAGG + Intergenic
1018172648 6:161154069-161154091 GACCCCCATGTGACTTCCACAGG - Intronic
1019064873 6:169288348-169288370 AGCCCCCATGTGTGTAACCCAGG + Intergenic
1019329707 7:456225-456247 GACCCCCAGGTCTCCCACTCCGG + Intergenic
1019329815 7:456510-456532 GACCCCCAGATCTCCCACCCTGG + Intergenic
1019329992 7:456966-456988 GACCCCCAGATCTCCCACCCTGG + Intergenic
1019330049 7:457109-457131 GACCCCCAGGTCTCCCACCCCGG + Intergenic
1019330136 7:457310-457332 GACCCCCAGGTCTCCCACCCCGG + Intergenic
1019330191 7:457440-457462 GACCCCCAGGTCTCCCACCCCGG + Intergenic
1019337219 7:491153-491175 AACCCCCATCTGTCTCCCTCAGG - Intergenic
1020110061 7:5442975-5442997 CACACCCATGTGGCCCACCCAGG - Intronic
1023958255 7:44905353-44905375 GAACCGCATGTGGCGCACCCTGG + Intergenic
1035707629 8:1689298-1689320 GACCCACCTGTGCCTCACCTGGG - Intronic
1046492562 8:114971747-114971769 GGCCCCTATGCGCCTCACCCAGG + Intergenic
1046848278 8:118943401-118943423 GACCCTCATGAGCCTCATCCTGG + Intronic
1047037830 8:120958812-120958834 TACTCCCCTGTCTCTCACCCTGG + Intergenic
1049463270 8:142739796-142739818 GACCTCCAAGGGCCTCACCCGGG - Intergenic
1049688317 8:143948121-143948143 GGCCCCCATGGGCCCCACCCAGG + Intronic
1056944285 9:90980719-90980741 GACACCAATTTGTGTCACCCAGG - Intergenic
1060581487 9:124750999-124751021 GACCCAAATGTGTCTGATCCAGG - Intronic
1061419713 9:130466621-130466643 GACCCCCATGGGCCCCTCCCAGG + Intronic
1188058944 X:25576845-25576867 GACCCCCATTTTTCTCATCAGGG + Intergenic
1190214844 X:48473160-48473182 GACTCCCATGTGTCACACAAGGG - Intergenic
1201344197 Y:12965218-12965240 GACACCCATGTATGTCATCCAGG - Intergenic