ID: 956871390

View in Genome Browser
Species Human (GRCh38)
Location 3:73421614-73421636
Sequence GCAGTTAAATTGAGGTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956871390 Original CRISPR GCAGTTAAATTGAGGTATCA AGG (reversed) Intronic
904230653 1:29067800-29067822 GCAGCTAAATAGAGTTACCAGGG + Intronic
905111951 1:35601916-35601938 TCCATTAAATTGATGTATCATGG - Exonic
905116815 1:35648640-35648662 TCAGTTAAATTGAGTTATGATGG - Intergenic
912012754 1:104989794-104989816 GAATTTAAACAGAGGTATCAAGG + Intergenic
912667662 1:111597254-111597276 CCAGTTTGATTGAGGAATCAAGG - Intronic
912901263 1:113652101-113652123 GCAGTTTAATTCAGAGATCAGGG + Intronic
919638937 1:200030731-200030753 GCAGTTAATTTGAAGAATTATGG - Intronic
920566160 1:206975191-206975213 TGAATTAAATTGAGATATCATGG + Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921829552 1:219711738-219711760 GAAGTTTAATTGTGGTATCTTGG + Intronic
923416041 1:233761211-233761233 GCAGTTAAAATGAGTGAACAAGG + Intergenic
923741787 1:236661230-236661252 ATAGTTAAATTGAGGAATTATGG + Intergenic
1063049370 10:2430112-2430134 TCAGTAAAATGGAGGTACCAAGG - Intergenic
1066354809 10:34672479-34672501 GCAGTTAAAGTTAGGAAACACGG - Intronic
1069213133 10:65786752-65786774 ACAGTTACATTGAGGGATTAGGG + Intergenic
1071378221 10:85032180-85032202 GCAGTTAAAGTGGGGTCTTATGG + Intergenic
1072798205 10:98372863-98372885 GCAGTTATTTTGAGTTATCATGG + Intergenic
1076506609 10:130978559-130978581 GCAGTTAAATTGTTGCTTCATGG + Intergenic
1078438102 11:11342074-11342096 GCAGGTAAGTTGTGATATCAAGG - Intronic
1083848724 11:65352776-65352798 GCAGAAAACTTGAGGAATCAGGG - Exonic
1085617417 11:78011744-78011766 ACAGTTAAATTAAGGTCTCTAGG + Intergenic
1088427220 11:109716969-109716991 TCATTTGAATTGATGTATCAAGG - Intergenic
1091041344 11:132284455-132284477 GCAGTTAAACTGAGGTCACTGGG - Intronic
1091043406 11:132303505-132303527 TAAGTTAAAATGAGGTATTATGG - Intronic
1091215687 11:133900010-133900032 GCAGTTAATTTGAGGACCCAAGG + Intergenic
1091842342 12:3630110-3630132 GCAGTGAGATGGAGGTATGACGG + Intronic
1098841447 12:75482948-75482970 TCAGTTGAAATGAGGTATGAAGG + Intronic
1098967786 12:76811135-76811157 TCAGTTAAAGTGAGTTAACAAGG + Intronic
1099307655 12:80978027-80978049 CCAGTTGAATTGTGGTTTCATGG - Intronic
1099488332 12:83255514-83255536 CCTGTTAAATTGAGGAAGCAAGG - Intergenic
1101576632 12:106003430-106003452 GCAGTAAAATTTATGAATCAGGG - Intergenic
1102325655 12:111981113-111981135 ACAGCTTAATTGAGGTATAATGG - Intronic
1104792402 12:131492381-131492403 ACTGTTGAATTGAGGCATCATGG - Intergenic
1105482847 13:20794896-20794918 GCAGTTAACTAGGGGTACCAAGG - Intronic
1105639471 13:22247513-22247535 GCAGTTTAAATGAGTTAGCAAGG + Intergenic
1109000055 13:56789064-56789086 TCAGTTAAAATGAAGTATCTTGG + Intergenic
1109018145 13:57047465-57047487 ACAGCTTTATTGAGGTATCATGG + Intergenic
1110091983 13:71463035-71463057 GCAGTTAAAGTGAGTTACCAAGG + Intronic
1112007247 13:95264822-95264844 GCACTAAAATTTAGGTATAAGGG + Intronic
1113196318 13:107811325-107811347 GCATTTAATTTGAGGTTTGATGG - Intronic
1114725019 14:24927063-24927085 GCAGAGAAATAGAGGTATAAAGG + Intronic
1117496206 14:56307986-56308008 TAAGTTAAAATGAGGTATGAAGG + Intergenic
1117688835 14:58284173-58284195 GCAGTCACATTGAACTATCATGG - Intronic
1118588209 14:67377166-67377188 GTCGTTAAAATGATGTATCATGG - Intronic
1121589123 14:95086963-95086985 GCAGTTAAAAAAAGGTATCAAGG + Exonic
1127160530 15:56179921-56179943 TCAGTTAAATTGATGTATAGTGG - Intronic
1130936758 15:88477479-88477501 GCAGGAATAATGAGGTATCAGGG + Intronic
1131681106 15:94724710-94724732 GCAGTTCTAATGAAGTATCATGG + Intergenic
1135529737 16:23242734-23242756 CCACTTAGATTGAGGTTTCAGGG - Intergenic
1137457874 16:48631911-48631933 GCAGTTGGTTTGAGGTATCAGGG - Intergenic
1146917107 17:36685047-36685069 GCAGTTCTATTGAGGAACCAGGG - Intergenic
1155408636 18:25517445-25517467 GCAGTTTAAACAAGGTATCACGG + Intergenic
1159227031 18:65552852-65552874 GCAGTTCAATTGAAGTAAAATGG + Intergenic
1163342957 19:16721596-16721618 GCAGCTAAACTGTGGTATCCAGG + Intronic
926327597 2:11798495-11798517 GCAGTTTACTTGGGGTGTCACGG + Intronic
927897039 2:26789536-26789558 GCAGTTAGATATAGGTATCTGGG - Intronic
930401669 2:50897091-50897113 ACTGTTGAAATGAGGTATCATGG + Intronic
931295735 2:60923284-60923306 GCAGTTGAAGTGAGCTTTCAAGG + Exonic
933340171 2:81014788-81014810 GGAGTTAAATTGAGACTTCAGGG + Intergenic
936741070 2:115509344-115509366 GCGGTTAGAATGATGTATCAGGG + Intronic
937424989 2:121791205-121791227 GCAGTCACATAGAAGTATCATGG + Intergenic
939316842 2:140561765-140561787 TCTGTTAAATTTAGGTATTAGGG - Intronic
939418103 2:141927211-141927233 GCAGTCAAATTGATGTATGATGG - Intronic
945710301 2:213286574-213286596 GTAATTTAATTGAGCTATCATGG + Intronic
947860150 2:233352871-233352893 GAAGTTAAAATGAGGTCACAGGG - Intergenic
1168939487 20:1696542-1696564 GGAGTTAAATTGAGGAACCTGGG + Intergenic
1173904866 20:46619086-46619108 GCAGTCAAATTGTTGTCTCAGGG + Intronic
1174189010 20:48726918-48726940 GCAGTTAAAATGAGATAACCAGG + Intronic
1174813500 20:53667087-53667109 TCAGCTAACTTGAGGTATTAAGG + Intergenic
1178228221 21:30749669-30749691 CCAGCTTTATTGAGGTATCAGGG + Intergenic
949194417 3:1288175-1288197 ACAGTTAAATAAAGGTCTCATGG - Intronic
949728566 3:7079604-7079626 GTAGTTGAATAGAAGTATCAAGG + Intronic
951821769 3:26821761-26821783 GCAGCTAAAGTCAGGTAGCAAGG + Intergenic
956871390 3:73421614-73421636 GCAGTTAAATTGAGGTATCAAGG - Intronic
957246859 3:77726323-77726345 AATGTTAAATTGAGGTATCTTGG + Intergenic
958863555 3:99472819-99472841 GCAGATGAATTTAGCTATCAAGG + Intergenic
963484029 3:145913553-145913575 GCAGTAAAGTTGAGGTCTAAAGG + Intergenic
971785764 4:31100243-31100265 GCAGTTTAATGGAGATATCGGGG + Intronic
972361289 4:38327912-38327934 TCAGTTGAATTAAGGTATAAAGG - Intergenic
976511808 4:85919527-85919549 GCCGTTAAAATGAGGAATGAAGG + Intronic
976961845 4:90986740-90986762 GTAGTTAAATTTAAGTTTCAAGG + Intronic
977193726 4:94032618-94032640 TCAGTTAAAGTGAGGTAGCCTGG - Intergenic
980228290 4:130015611-130015633 GCAGTTAAATTGCCTGATCAAGG - Intergenic
981495665 4:145389326-145389348 ACACTTAAATTGAGGCATGAAGG - Intergenic
982062232 4:151616192-151616214 ATAGTTTAATTGAGGTATAAAGG + Intronic
985216571 4:187659320-187659342 CCAGTTAAATTGAGATCTAAAGG + Intergenic
986315723 5:6585106-6585128 CAAGTTAAATCGAGTTATCAGGG + Intergenic
991552743 5:67859509-67859531 GCAGTTAAAAAATGGTATCAAGG - Intergenic
991928267 5:71726604-71726626 GCAGAGAAGTTGAGCTATCAGGG + Intergenic
994815139 5:104576313-104576335 GCAGTTGAAGTGAGCTTTCAAGG - Intergenic
998398141 5:141832846-141832868 AGAGTTAAATTTATGTATCAAGG + Intergenic
998903947 5:146883419-146883441 GCAGTAAAACTGAGGTTTCTAGG - Intronic
1006499532 6:34449036-34449058 GCAGATAATGTGACGTATCAAGG + Intergenic
1007646643 6:43387590-43387612 CCAGTTAAATTGAGATCTAAAGG - Intergenic
1007804124 6:44425388-44425410 TCAGATGAATTGAGGTCTCATGG + Intronic
1008896954 6:56566801-56566823 GCAGTTACATGGTGTTATCATGG + Intronic
1008901926 6:56629924-56629946 GAAGTTAATTTAAGATATCAAGG - Intronic
1015414633 6:132934471-132934493 GTAGTTAAATTAAGGAATCCAGG + Intergenic
1017935831 6:159004020-159004042 GCAGTGACCTGGAGGTATCAGGG - Intergenic
1018346073 6:162900283-162900305 GGAGTAAAATTGATGTCTCAGGG - Intronic
1018617160 6:165697831-165697853 GCAGTTAAATATAGGTAAAATGG + Intronic
1021274750 7:18636411-18636433 GCTGTTAACTTGACTTATCATGG + Intronic
1021854959 7:24846164-24846186 GCAGTTAAAATAAGGGATGATGG - Intronic
1022716071 7:32899744-32899766 GAAGTTAAAATGAGGTAACTTGG + Intergenic
1022916375 7:34958612-34958634 GAAGTGAAATTGATGGATCAAGG + Intronic
1026542505 7:71292496-71292518 ACAGTTTTATTGAGCTATCATGG + Intronic
1028113794 7:86974319-86974341 GAAGTGGAATTGAGGTATCACGG - Intronic
1031385095 7:121139884-121139906 TCAGTAAAATTGAAGTATCTTGG - Intronic
1031859319 7:126959390-126959412 GCAGTGAACTTGAGGAATAAAGG + Intronic
1033083753 7:138322850-138322872 GCAGCTTCATTGAGGTATGAAGG + Intergenic
1037322942 8:17660795-17660817 GAAATAAAATTGAGGCATCAAGG + Intronic
1041094311 8:54333729-54333751 GATGTTAACTTGAGGGATCAGGG + Intergenic
1042711476 8:71722306-71722328 GCAGTTTCATTGCTGTATCAAGG - Intergenic
1044348397 8:91133930-91133952 TCACTTAAATTGAAATATCAAGG - Intronic
1046323684 8:112612780-112612802 AAAGTTAAAGTGAGGTATGATGG - Intronic
1051176760 9:14368685-14368707 CCAGTTAAATTGAGATAATATGG - Intronic
1054895350 9:70304151-70304173 GAAGTTACAGTGAGGTATGATGG - Intronic
1055442421 9:76349578-76349600 ATAGTTAAATTGACGTTTCATGG - Intronic
1058002333 9:99878827-99878849 GCAATTTAATTCAGGTCTCAAGG + Intergenic
1058840363 9:108901619-108901641 TCAATGACATTGAGGTATCAAGG - Exonic
1185742153 X:2542365-2542387 GCACTTAAATTGAGGAAGGATGG - Intergenic
1188074360 X:25756948-25756970 GCAGTTACATTGGGGTGACAGGG - Intergenic
1192273273 X:69604586-69604608 ATAGTTAAATTGAAATATCATGG - Intergenic
1193730101 X:85092535-85092557 GCAGTTACATTGAGTTGTGATGG + Exonic
1193993159 X:88333759-88333781 GGATTGAAATTGAGGTGTCAGGG - Intergenic
1194673379 X:96764251-96764273 GCACTTAAATTGGGCTTTCAGGG + Intronic
1195595141 X:106680351-106680373 GAAGTAAACTTGAGGTATAAAGG + Intergenic
1195718779 X:107845414-107845436 GCAGTTACATTTACATATCAGGG + Intronic
1196736161 X:118982587-118982609 GCTGGTAAATTGTGGAATCAGGG - Intronic
1198089557 X:133314098-133314120 GCATTTGAATTTAGGTAACAAGG + Intronic