ID: 956881873

View in Genome Browser
Species Human (GRCh38)
Location 3:73519249-73519271
Sequence CTCTGGCCTCCTCTTTACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956881873_956881875 9 Left 956881873 3:73519249-73519271 CCAGCGTAAAGAGGAGGCCAGAG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 956881875 3:73519281-73519303 GAATGAAAAACAGCAAGCTGTGG 0: 1
1: 0
2: 5
3: 47
4: 459
956881873_956881876 15 Left 956881873 3:73519249-73519271 CCAGCGTAAAGAGGAGGCCAGAG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 956881876 3:73519287-73519309 AAAACAGCAAGCTGTGGAACAGG 0: 1
1: 0
2: 0
3: 25
4: 314
956881873_956881877 18 Left 956881873 3:73519249-73519271 CCAGCGTAAAGAGGAGGCCAGAG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 956881877 3:73519290-73519312 ACAGCAAGCTGTGGAACAGGAGG 0: 1
1: 0
2: 3
3: 40
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956881873 Original CRISPR CTCTGGCCTCCTCTTTACGC TGG (reversed) Intronic
902920770 1:19665098-19665120 CGCTGCCCTCCTCTTCCCGCGGG + Intergenic
903166631 1:21524900-21524922 CTCTGGCCTCCCCCTGACCCTGG - Intronic
903647350 1:24903320-24903342 CTCTGGCCTCCACCTCACCCTGG + Intronic
906866280 1:49424011-49424033 CTCTGGCCTGCTCTATGCCCTGG + Intronic
911241320 1:95470743-95470765 CTCTTCCCTCCCCTTTACACAGG + Intergenic
915266071 1:154719012-154719034 CTCTGGCCACCTCTCTGCCCAGG + Intronic
917536000 1:175875127-175875149 CTTTTGCCTCCTCTTCACGGAGG + Intergenic
924118664 1:240773899-240773921 CTCTGGCCTTCCCTTGAAGCAGG + Intergenic
1063101200 10:2951385-2951407 CTCTGCCCTCCTCTTCCCACCGG + Intergenic
1066186671 10:33016201-33016223 CTCTAGCCTTCTCTTGAGGCAGG + Intergenic
1067832130 10:49616393-49616415 CTCTGGCCTCCTCATGGGGCTGG + Intronic
1069840586 10:71337084-71337106 CTCTGGCCTCCCCTTCAGCCTGG + Intronic
1070334605 10:75444062-75444084 CTATGGCCACCTGTTTATGCTGG + Intronic
1074275617 10:111999252-111999274 CTCTGGCCTCCACCTTCCCCTGG - Intergenic
1078854090 11:15192152-15192174 CTCTGGGCTCCTCTTCAGCCTGG - Intronic
1078958869 11:16239385-16239407 TTCAGGCCTGCTCTTCACGCTGG + Intronic
1080173460 11:29334150-29334172 CTCTGGCCTCCTCTGTCTGGGGG + Intergenic
1083224547 11:61276676-61276698 CTCTTGCCTCCTCCTCAGGCTGG - Exonic
1083508451 11:63183817-63183839 CTCTGTCCTCTTCTTTGCTCAGG - Exonic
1083895036 11:65615814-65615836 TTCCGGCCTCCTCCTTAGGCCGG + Exonic
1084092200 11:66886108-66886130 CTCTGCCCTGCTCTCCACGCAGG - Intronic
1084762066 11:71280235-71280257 CTCTGGCCTCCATTTTACTAGGG + Intergenic
1085241365 11:75058994-75059016 CTCCAGCCTCTTCTTTACTCAGG - Intergenic
1087591853 11:100199368-100199390 CTTTGGCCTGCTCTGAACGCTGG + Intronic
1088938159 11:114425669-114425691 CTCTTGCCTCCACTTTCCACAGG + Intronic
1089620821 11:119721242-119721264 CTGTGTCCTCCTCTTCAGGCAGG + Intronic
1092190594 12:6517072-6517094 CACTGGATTCCTCTTTACACTGG - Intronic
1092447082 12:8567926-8567948 CTCTGCCCTCTACTTTACTCTGG + Intergenic
1096291973 12:50351256-50351278 CTCTGGGCTCCTCTTTCTCCTGG - Exonic
1096779615 12:53984512-53984534 CTCCCGCCTCCTCTTTTCCCCGG - Intergenic
1096978846 12:55716927-55716949 CTCTCGCCTCCTCTTTTCTGGGG - Exonic
1100370364 12:93963906-93963928 CTCTGGAATCCTCTTTACCTAGG + Intergenic
1101727275 12:107398446-107398468 TTCTAGCCTCCTCTTTCCGCTGG - Intronic
1102150658 12:110687605-110687627 CTCTTGCCGCCTCATCACGCTGG - Intronic
1102648621 12:114420322-114420344 CTCTGACCTCCTGTTTTCCCTGG + Intergenic
1107178162 13:37423511-37423533 CTCTTCCCTCCTCTTTCCACAGG - Intergenic
1107225284 13:38041623-38041645 CTCTGGCCCCCAATTTAAGCAGG - Intergenic
1108591146 13:51913912-51913934 CTCTGGCATTCTCTTTCTGCCGG - Intergenic
1115054187 14:29102397-29102419 CTCTAGCCTCTTCCTTATGCTGG - Intergenic
1122153202 14:99735584-99735606 CTCTGTCCTCCTCTTTCCGTGGG - Intergenic
1124349396 15:28944050-28944072 CCCTGGCCTACTCTTCACCCTGG + Intronic
1129444839 15:75609703-75609725 CTCTTGCCTCCTCATTCTGCAGG + Intronic
1129993511 15:79985019-79985041 CTCTGCCTTCTTCTTTACACAGG - Intergenic
1130110137 15:80957340-80957362 GGCTGGACTCCTCTTTACCCAGG - Intronic
1132581616 16:687290-687312 CTCTGGCCGCCACTTCACACGGG + Exonic
1134291037 16:12902885-12902907 CTCTGGCCGCCTCCTCCCGCTGG + Intronic
1134297013 16:12955314-12955336 CAATGGCCTCCTCTCTAGGCTGG + Intronic
1136540708 16:30926284-30926306 CTCTGGCCTCTTCCTCACCCAGG + Intronic
1146269722 17:31476956-31476978 CTGTGGCCTCCTGTTTATTCAGG + Intronic
1148740702 17:49890845-49890867 CGCTGGCCTCCTGTTCCCGCTGG + Intergenic
1149984904 17:61339917-61339939 ATCTGGCCTCATCTTTCAGCAGG - Intronic
1150323431 17:64235992-64236014 CTCTGTCTTCCCCTTTACACTGG + Intronic
1150847748 17:68676823-68676845 CTCTGGGCTCCACTTTAAGGTGG - Intergenic
1153429558 18:5000571-5000593 CTCTTCCCTCCCCTTTACTCAGG - Intergenic
1157012328 18:43665806-43665828 CTCTTGCCTCGTCTTGACGGAGG - Intergenic
1163458942 19:17424875-17424897 CTTTGGCCCTCTCTTTACTCTGG + Intronic
1166807966 19:45498345-45498367 CTTTGACCTGCTCTTTAGGCGGG - Intronic
1167188374 19:47964499-47964521 CTCTGGCCTCCTCTTACCCCTGG + Intergenic
925743014 2:7021533-7021555 CTCTGCCCTCCTCCTTTCCCTGG + Intronic
926144221 2:10386928-10386950 CTCTGGCCTCCACATGAGGCAGG + Intronic
926957696 2:18319554-18319576 CTCTGGCCTCATCTTTCCTCAGG - Intronic
927570208 2:24152922-24152944 CTCTTCCCTCCCCTTTACACAGG + Intronic
930021579 2:47004899-47004921 CTCTGCCCACCTCTATACCCTGG - Intronic
934769722 2:96900141-96900163 CTCTGGCCTCCACTCTGCGCTGG + Intronic
937280785 2:120715998-120716020 CTCTGGCCTCCTCTTCTCTAGGG - Intergenic
945963878 2:216164866-216164888 CTCTGGCCTCCTGTGTGCTCAGG - Intronic
1178083718 21:29092315-29092337 CTCTTGCCTCCTCTTTAGAGAGG - Intronic
1178311735 21:31535591-31535613 CTCTGACATCCCCTTTACGTGGG - Intronic
1179171560 21:38976905-38976927 CTCTGAGCTCTTCTTTGCGCTGG - Intergenic
1179287753 21:39992638-39992660 CTCTGCCCTCTTCTTTCCACTGG + Intergenic
1179591741 21:42413552-42413574 CTTTGGTCTTCTCTTTAGGCGGG + Intronic
1183125777 22:35780187-35780209 CTCTGGCCTTCTCTTTAGTGCGG + Intronic
1183185509 22:36289371-36289393 CTCTGGGCTCCTCCTTCCCCAGG - Intronic
1183341542 22:37284461-37284483 CTCTGGCCTCCTCCTCAAGGAGG - Intronic
950052975 3:10006036-10006058 ATCTGGCTTCCTCTGTAGGCTGG - Intronic
953019718 3:39105804-39105826 CTCTGGTCTCCTCCTCACACTGG + Intronic
955769185 3:62372271-62372293 GTCTGGCCTCCTCAATGCGCAGG - Exonic
956881873 3:73519249-73519271 CTCTGGCCTCCTCTTTACGCTGG - Intronic
957025626 3:75178399-75178421 CTCTGGCTTCCTCTTGGCTCAGG - Intergenic
960564975 3:119123261-119123283 TTCTTCCCTCCTCTTTACACAGG - Intronic
965930082 3:174031340-174031362 CTCTGGGCTTCTCTTTAGGATGG - Intronic
966808272 3:183822958-183822980 CGCTGGGCTCCTCTTTACTAGGG + Intronic
967424967 3:189316506-189316528 CACTGGCTTCCTGTTTACACTGG - Intronic
972666248 4:41167882-41167904 CTCTGGCCTCCTCTGCTAGCTGG - Intronic
973822806 4:54677539-54677561 CTCTTGCCTCCTCTTTCCTCGGG + Intronic
975313077 4:72925226-72925248 CTCTTCCCTCCCCTTTACACAGG + Intergenic
977532270 4:98214345-98214367 CTCTGCCTTCCTCTTTACATAGG + Intergenic
977700548 4:100017248-100017270 CTCTGCCCTCCTCTCTTCCCAGG - Intergenic
986902774 5:12457611-12457633 CTCTGCCCTCTACTTTACTCTGG + Intergenic
987059447 5:14228047-14228069 CCCTGGCCTCCTCTCCACACAGG - Intronic
987278074 5:16383336-16383358 CTCTTTCCACCTCATTACGCTGG + Intergenic
988039787 5:25874469-25874491 CTCTTTCCTCCTCTTTCCGTAGG + Intergenic
998498033 5:142607844-142607866 CTCTGGGCTCCCCTTTATGTAGG - Intronic
1000270280 5:159677447-159677469 CTCTGCCCTCCTCTTTCCAAAGG - Intergenic
1001585061 5:172828196-172828218 CTCTGGCCTCGTCTTGAGGCAGG - Intergenic
1003084198 6:3048427-3048449 CGATGGCCTCCTCTTCAGGCAGG + Intergenic
1005922879 6:30416851-30416873 CTGTGGCCTCCTCTTGCTGCAGG + Intergenic
1005996023 6:30931983-30932005 CTCTGGCCTCTTCTTGCCACAGG + Intronic
1006148598 6:31973981-31974003 CTCTGGGTTCCTCTTAACTCAGG - Intronic
1006462885 6:34173756-34173778 CTCTTCCCTCCCCTTTCCGCAGG + Intergenic
1007372996 6:41439056-41439078 CTCTGGCCTCCTCTGTAGCTAGG - Intergenic
1013687511 6:112601946-112601968 CTCTTCCCTCCTCTTTCCACAGG - Intergenic
1019200265 6:170308048-170308070 CTCTGGCCTCCCCTTCACATAGG + Intronic
1019732757 7:2636894-2636916 CTCTGGCCACCTCTGTCCCCAGG + Intronic
1023686193 7:42737861-42737883 CTCTGGCCTTCTCATCACCCAGG + Intergenic
1023896603 7:44438980-44439002 CACTGGCCTCCTCTTCACCGAGG - Intronic
1024662370 7:51510767-51510789 CTCTTCCCTCCCCTTTACACAGG + Intergenic
1025248510 7:57336055-57336077 CTCTGCACACCTCTTTACTCTGG + Intergenic
1026101808 7:67390089-67390111 CAGTGACCTCCTCTTTATGCTGG + Intergenic
1026593064 7:71712835-71712857 CTCTGGCTTCCTCTAGACACAGG - Exonic
1033319400 7:140326270-140326292 CCCTGGCCTCCTATTTCCGCTGG - Intronic
1033544690 7:142389299-142389321 CTGTGTCCTCCACTTTACACTGG + Intergenic
1035067387 7:156116995-156117017 CTCAGGCCGCCTCTGGACGCTGG + Intergenic
1038634475 8:29274277-29274299 CTCTGGGCTCCACTTTATTCTGG + Intergenic
1040376099 8:46826065-46826087 CTCTGGCCTGGTCTTTACAAGGG + Intergenic
1046384051 8:113486244-113486266 CTCTTCCCTCCTCTTTCCACAGG + Intergenic
1046712076 8:117521106-117521128 CTCTGGTTTCCTCTTTACGTGGG + Intronic
1048387632 8:133927372-133927394 ATCTGACCTCCTCTTGACCCAGG - Intergenic
1049438228 8:142597459-142597481 CTCAGGCATCCTCTGCACGCAGG - Intergenic
1057546157 9:96021586-96021608 CACTGGCCTCGTCTTCGCGCGGG - Intergenic
1058952250 9:109914903-109914925 CTCTTGCCTCCTCTTTTAGTTGG + Intronic
1059081968 9:111259798-111259820 CTCTTGCCTCCTCTCTCAGCAGG - Intergenic
1059463367 9:114449510-114449532 CTCTGGCCTGGTCTTTACAGCGG - Intronic
1061073403 9:128325950-128325972 CTCAGGGCTCCTCTTTCCTCAGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1185693492 X:2175882-2175904 CTCTGGACTCCTCTTGATGAGGG - Intergenic
1187209547 X:17215561-17215583 TTCTGTTCTCCTCTTTACACTGG - Intergenic
1188412506 X:29891101-29891123 CTCTGGCCTCCTCCTGACAAAGG + Intronic
1188839349 X:34996576-34996598 CACTGGCCTCCTATTTTTGCTGG - Intergenic
1191627334 X:63283279-63283301 CTCTGGCCTCCCTTTTTGGCTGG - Intergenic
1193911929 X:87316776-87316798 CTCTTTCCTCCCCTTTACACAGG + Intergenic