ID: 956887001

View in Genome Browser
Species Human (GRCh38)
Location 3:73570180-73570202
Sequence TACATGCCCATTGTTGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956887001 Original CRISPR TACATGCCCATTGTTGTCCT TGG (reversed) Intronic
902375883 1:16029779-16029801 TTCATGCCCATCTTTATCCTTGG + Exonic
904558357 1:31380347-31380369 CAGATGCCCACTGTTGTCCCTGG + Intergenic
907951139 1:59185264-59185286 TACATTCTCATTGTTGTCTTAGG + Intergenic
908651646 1:66339188-66339210 AACATGTCCACTGTTTTCCTTGG + Intronic
910730373 1:90389012-90389034 TATATGCCCATTGTTGGTATGGG + Intergenic
911274663 1:95846843-95846865 TGCTTGCCCATTGTTTTCCATGG - Intergenic
912187475 1:107295477-107295499 TACAAACCCATTGTTCTCTTTGG - Intronic
913389002 1:118289901-118289923 TCCATGCCCATTCTTGGCCCTGG - Intergenic
916503988 1:165411147-165411169 AACTTTCCCACTGTTGTCCTGGG - Intronic
920353826 1:205355889-205355911 TACATACACATTGCTGTGCTTGG - Intronic
920714908 1:208331044-208331066 TAAATCCCCATTTTTTTCCTTGG + Intergenic
920854908 1:209654301-209654323 GACATGCCAATTGCTGTGCTTGG + Intergenic
921950710 1:220927164-220927186 TACATTCTTATTTTTGTCCTTGG + Intergenic
1069371273 10:67750317-67750339 AAGATGCCCATTGTGGGCCTGGG + Intergenic
1069918320 10:71800703-71800725 TACATCCCCAGGGTTGTCTTTGG - Exonic
1072221873 10:93333755-93333777 TACCAGGCCATTGTTGTCCTGGG + Exonic
1073484427 10:103807679-103807701 TACATGCTCCTTGTTCCCCTGGG + Intronic
1073802300 10:107055393-107055415 TACATGTCCAAAGTTTTCCTAGG + Intronic
1074042593 10:109806654-109806676 TATATGCCCTTTGTTTTTCTTGG - Intergenic
1078379260 11:10825329-10825351 CCCATGCCTATTTTTGTCCTTGG - Intronic
1078963728 11:16311957-16311979 CACATGCTCATTCTTGTGCTGGG + Intronic
1080849123 11:36052812-36052834 TACATGCAACTGGTTGTCCTTGG + Intronic
1081635133 11:44716055-44716077 TATATGCCCAGTGTTTACCTAGG + Intergenic
1083206532 11:61153073-61153095 TATGTGCCCAGTGTTGACCTAGG - Intronic
1084665908 11:70576166-70576188 TACAAGCCCTTTGTTGTCACAGG + Intronic
1086156589 11:83673195-83673217 CACATGCTCATTGTTGTGCAGGG + Intronic
1087049464 11:93870724-93870746 TTCCTGCCCATTGTTCTCCATGG - Intergenic
1089732474 11:120527756-120527778 TACAGCCTCATTGTTGTCCAAGG + Intronic
1090524062 11:127510735-127510757 TACATGTCCATTGTTTTCTGTGG + Intergenic
1092618680 12:10238887-10238909 GACCTACCCATTGTTATCCTTGG - Intergenic
1098261637 12:68677265-68677287 TACATTCACATTGTTGTGCAGGG - Intergenic
1099659655 12:85540257-85540279 AACATGCCCATTTTTGTTGTTGG + Intergenic
1102287129 12:111667161-111667183 TACATTTCCATTGTTTTACTTGG + Intronic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1107332820 13:39319978-39320000 TCCATGACCAATGTTATCCTTGG + Intergenic
1107826953 13:44337421-44337443 TACATGCCCAGGATTGTCCTTGG + Intergenic
1110520623 13:76472027-76472049 TACATCCCCTTTGCTGTCCCAGG + Intergenic
1111966180 13:94864408-94864430 AATATGCCCATCGTTTTCCTAGG - Intergenic
1113724198 13:112586307-112586329 TACATTCCCATTGTTATAATTGG - Intronic
1116509853 14:45731360-45731382 TACATGCCCGGTGTTGCGCTGGG + Intergenic
1118284218 14:64456591-64456613 CACATGCCCATTGTTGTAGACGG - Intronic
1124782756 15:32651594-32651616 TACAAGCCCAATGTTCTCATTGG - Intronic
1127251767 15:57246267-57246289 TAAATCCCCAGTGTTTTCCTTGG + Intronic
1127315471 15:57790422-57790444 TACATGTCCATTGTTGAGGTTGG + Intergenic
1128203363 15:65829040-65829062 TGCATCCCCATTGGTTTCCTAGG - Intronic
1132633240 16:929881-929903 TACACGACCACTGCTGTCCTGGG - Intronic
1133288545 16:4702782-4702804 TACATGCCCCTTTTTCTGCTTGG - Intronic
1136088180 16:27900389-27900411 TACTTGCCCATTATGGCCCTGGG - Intronic
1138063499 16:53915998-53916020 AACATGACTTTTGTTGTCCTTGG + Intronic
1138375013 16:56557352-56557374 TACAATCCCTCTGTTGTCCTGGG + Intergenic
1139769061 16:69257904-69257926 TACATGCCAAATATTGTGCTAGG - Intronic
1146374848 17:32287170-32287192 CACATGCCCAGTGCTGTGCTGGG - Intronic
1148122148 17:45219641-45219663 TACATGCCCATCACTGTGCTTGG - Intergenic
1149403848 17:56326918-56326940 TACATGTCCATTGATTCCCTTGG - Intronic
1150833423 17:68542961-68542983 TAAAGGCCCAGTGTTGACCTGGG - Intronic
1152343304 17:79737210-79737232 TAGGTGCCCATCGTTGGCCTCGG - Exonic
1154445884 18:14435136-14435158 CACATGCCCATTGAAGCCCTTGG - Intergenic
1164760944 19:30727852-30727874 CACAAGCCCAGTGGTGTCCTGGG - Intergenic
1167508431 19:49883125-49883147 AACTTGCCCATTGGTGCCCTAGG - Intronic
1167608551 19:50494804-50494826 TAAATGCACATTGTCGTCCTTGG + Intergenic
925383427 2:3444808-3444830 TCTAGGCCCCTTGTTGTCCTGGG + Intronic
928535741 2:32239412-32239434 TAAATGTTCATTGTTGTCATGGG + Intronic
934737813 2:96698813-96698835 TACCAGGCCATTGTAGTCCTGGG - Intergenic
937530719 2:122824128-122824150 AACATGCACAGTGGTGTCCTGGG + Intergenic
941547989 2:166877899-166877921 TAGATGTCAATTGTGGTCCTTGG + Intergenic
941870288 2:170377382-170377404 TCTATGCCCACTGTTGTCTTAGG + Intronic
943783823 2:191854063-191854085 CACATTTCCGTTGTTGTCCTTGG - Intergenic
947043446 2:225949922-225949944 TACATGCCACTTGTGGGCCTGGG + Intergenic
947399672 2:229718472-229718494 AACTTGCCCAGTGTTGTCATGGG - Intergenic
948506132 2:238427870-238427892 TACATGCCTATATTTGTCTTTGG + Intronic
1175542300 20:59755412-59755434 TACGTCCCCACTGTTGTCCTTGG + Intronic
1182816272 22:33166753-33166775 CACATGCCTATAATTGTCCTCGG - Intronic
1183370467 22:37428889-37428911 CACAGGCCACTTGTTGTCCTGGG + Intergenic
1185308285 22:50135813-50135835 TACATGCCAGGTATTGTCCTGGG + Intronic
951850155 3:27130160-27130182 TACAAGCCCATGGTGGTCTTTGG - Intronic
952271359 3:31835091-31835113 TATATGGCCATTTTGGTCCTTGG + Intronic
952797822 3:37257799-37257821 ACCATGTCCATTGTTATCCTGGG + Intronic
953449010 3:42990927-42990949 TACATGCCCATAGTTCCCCCAGG - Intronic
953686977 3:45085701-45085723 TACATCCCCATTGTTGGGATGGG + Exonic
954519408 3:51210941-51210963 TTCATTTCCATTGTTGGCCTTGG + Intronic
955117090 3:56016697-56016719 TAAATGCCCATGGGTTTCCTAGG - Intronic
955373423 3:58373483-58373505 TTACTGCCCATTGTTGACCTTGG + Intronic
956887001 3:73570180-73570202 TACATGCCCATTGTTGTCCTTGG - Intronic
961137396 3:124524689-124524711 TACATACACATTGTTGGACTAGG - Intronic
963718900 3:148837289-148837311 TATGTGCCTATTGCTGTCCTGGG - Intronic
965958977 3:174406234-174406256 TAAATGCCCCTTTTTGTTCTGGG + Intergenic
968415700 4:431981-432003 TACATGGCCTTTATTGTGCTGGG - Intronic
969099626 4:4759224-4759246 TTCATGGTCATTGTTTTCCTTGG + Intergenic
969509284 4:7608469-7608491 TACATGCCAGGTGTTGTCCTGGG - Intronic
969551648 4:7872516-7872538 AACATGCTCACAGTTGTCCTGGG - Intronic
971157011 4:24093990-24094012 CACATGCCCTTTTTTGTCCAAGG + Intergenic
971354255 4:25880064-25880086 TATATGCCAAGTGTTGTGCTTGG - Intronic
971610841 4:28724407-28724429 TACATGCACATTTTTTACCTGGG + Intergenic
972692742 4:41415673-41415695 TACATGTCCATTATTATGCTGGG + Intronic
973625104 4:52763783-52763805 TAAATGCCTATTGATATCCTTGG + Intergenic
974871523 4:67649413-67649435 TATCTGCCCATTTTTGTCTTTGG + Intronic
977305335 4:95317391-95317413 TACATTCCCATTGTGTTGCTAGG + Intronic
982287027 4:153746463-153746485 TGCATGCCCATAGCTCTCCTAGG + Intronic
982287032 4:153746500-153746522 TGCATGCCCATAGCTCTCCTAGG + Intronic
982287037 4:153746537-153746559 TGCATGCCCATAGCTCTCCTAGG + Intronic
982287047 4:153746611-153746633 TGCATGCCCATAGCTCTCCTAGG + Intronic
985090725 4:186360203-186360225 TGCATTCCCCTTCTTGTCCTGGG + Intergenic
987122625 5:14781376-14781398 GACTTGCCCAATGTTGTCTTGGG - Intronic
989180753 5:38574416-38574438 TACATGGCCATTGTTTACCATGG + Intronic
992634714 5:78716463-78716485 TACACCCCCATTGTGATCCTTGG - Intronic
993965380 5:94354184-94354206 TATATGGCCAATGTTCTCCTGGG - Intronic
994236560 5:97369580-97369602 CACAGGCCCCTTGTTATCCTGGG - Intergenic
998187590 5:139994148-139994170 TATATGCCCATTTCTATCCTGGG + Intronic
1001859350 5:175039795-175039817 TCCTTGCCCATTGTCCTCCTTGG + Intergenic
1003483334 6:6553323-6553345 TCCATGCCCATTCTTGCCTTTGG - Intergenic
1004260988 6:14107645-14107667 TACATGCCCAATGCTATTCTTGG + Intergenic
1005216450 6:23533747-23533769 TACATTCCCATTATAGTCCACGG - Intergenic
1007278419 6:40692450-40692472 GCCTTGCTCATTGTTGTCCTTGG - Intergenic
1007542610 6:42662256-42662278 TGCATGCCCATTGTTGGCAAAGG + Exonic
1009587883 6:65629434-65629456 TGCATGTCCATTGTTCTTCTAGG + Intronic
1011506758 6:88053195-88053217 TCCATGCGATTTGTTGTCCTAGG + Intronic
1011868285 6:91859859-91859881 TACATGCCCATAGCAGTGCTTGG - Intergenic
1015076027 6:129158691-129158713 CACATGCCCCCTGTTGTCATAGG - Intronic
1016045971 6:139480921-139480943 ACCATTCCCATTGTTGTGCTTGG + Intergenic
1016071430 6:139743738-139743760 TACAAGGCACTTGTTGTCCTTGG + Intergenic
1022718900 7:32924905-32924927 TTCATCCCCATTGATGCCCTAGG - Intergenic
1029340466 7:99939670-99939692 TAGATGCCCTTTGAGGTCCTTGG - Intergenic
1032718072 7:134527945-134527967 AAGATGCCCATTGTGGGCCTGGG + Exonic
1032722925 7:134565514-134565536 AAGATGCCCATTGTGGGCCTGGG + Intronic
1036217859 8:6895882-6895904 TACGTGCCAACTGTTGTCATGGG - Intergenic
1039409548 8:37341251-37341273 TACATGCCCATTGTTGATTCCGG - Intergenic
1043102824 8:76067714-76067736 GACATGCCTATTTTTGTCCATGG - Intergenic
1045829286 8:106438926-106438948 TGCATCCCCATTGCTGTTCTTGG + Intronic
1046125621 8:109903192-109903214 TACATGCCCATTGTTTGTGTTGG + Intergenic
1047638592 8:126794267-126794289 TAGATGTCTATTGTTGTTCTCGG + Intergenic
1048802016 8:138202765-138202787 TACACGCTCATTGATGGCCTCGG + Intronic
1058359997 9:104133870-104133892 TTCATGCCCCTTTTTCTCCTGGG + Intronic
1058544912 9:106050958-106050980 TACATTCCCATCTTTGTCTTCGG + Intergenic
1061972551 9:134052836-134052858 TGCATGCTCATTTTTGACCTGGG - Intronic
1186285649 X:8041393-8041415 TTAAAGCCCATTGTTGTGCTGGG + Intergenic
1191729479 X:64318005-64318027 TCCATGCCCTGTGTTGTCATTGG - Intronic
1192728505 X:73778212-73778234 AACATGCCCATCCATGTCCTGGG - Intergenic
1195944339 X:110192861-110192883 TACACGCCCATACTTGCCCTCGG + Intergenic