ID: 956887649

View in Genome Browser
Species Human (GRCh38)
Location 3:73576628-73576650
Sequence CTCTTTAAGAAACTTGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956887649 Original CRISPR CTCTTTAAGAAACTTGTGTT TGG (reversed) Intronic
900378277 1:2370407-2370429 ATCTTTGTGAAACTTGGGTTAGG + Intronic
901272534 1:7963675-7963697 CTCTTTAAGAAACGAGTCTGAGG - Intronic
901623256 1:10606113-10606135 CTCTTTAAGCCACTCTTGTTTGG - Intronic
908336580 1:63131538-63131560 CTTTTTCAGAAACTTTTGCTGGG - Intergenic
916274973 1:162984190-162984212 CTCTTTGAGAATCCTGTGGTTGG + Intergenic
918455534 1:184708797-184708819 TCCTTTAAGAAATTTGTGTCTGG + Intronic
919066630 1:192699136-192699158 CTTGTTAAGAACCTTGTCTTTGG - Intergenic
923381328 1:233421298-233421320 CTTTTTATGAATCATGTGTTTGG + Intergenic
924308365 1:242715084-242715106 CTCTTTAAGAAAGTAGCATTTGG - Intergenic
924394093 1:243598713-243598735 CTCTTTGAGGAAGTAGTGTTAGG - Intronic
1062773944 10:129736-129758 CTCTTTAAGAGACTTATTCTTGG - Intergenic
1063246394 10:4224122-4224144 CTCTTAAATAAAGTTTTGTTGGG + Intergenic
1063922268 10:10944897-10944919 CTCTTTAAGAAACATCTGGCTGG - Intergenic
1065062767 10:21924609-21924631 CTCTTTAGCTAACTTGTTTTGGG - Intronic
1066651231 10:37656998-37657020 CTCTTTGAGCTTCTTGTGTTTGG + Intergenic
1068037131 10:51774890-51774912 CCTTTTAAGACATTTGTGTTTGG + Intronic
1068177486 10:53479877-53479899 CTGGTTAAGAAAGTTCTGTTGGG - Intergenic
1069316881 10:67115709-67115731 CTTTTAAAGAAATTTGTGATAGG + Intronic
1069528071 10:69191778-69191800 CTGTTTAAGAAACTATGGTTTGG + Intronic
1070297999 10:75180808-75180830 CTGTTTTAGAAACATCTGTTTGG + Exonic
1072334197 10:94383056-94383078 CTCTTTTAGGATCTTGTTTTTGG + Intergenic
1072583953 10:96765099-96765121 TTCCTCAAGAACCTTGTGTTCGG - Intergenic
1075583382 10:123639367-123639389 CTGTCTAAGAAGCCTGTGTTAGG + Intergenic
1076483033 10:130797231-130797253 CTCTTTGAGGAAGTTGAGTTGGG + Intergenic
1077922192 11:6649980-6650002 CTCCTTAAGAGAGTTGTTTTGGG - Intronic
1080395027 11:31882354-31882376 GTCTTTAAGCTACTTGTGTGGGG - Intronic
1081417550 11:42834077-42834099 CTCTTTGAGACCTTTGTGTTAGG - Intergenic
1082082335 11:48021931-48021953 CTCTTTAAGAAACATGGGCATGG + Intronic
1082730325 11:56788826-56788848 CTTTTTAAAAAACTTCTTTTTGG + Intergenic
1082956950 11:58880152-58880174 CTCTTTAAGAAACTGTTGGCCGG - Intronic
1083341920 11:61963738-61963760 ATATTTAAGAATCTTGTCTTGGG + Exonic
1084048167 11:66582556-66582578 TTCTTTAAGAAAATTTTTTTGGG - Intergenic
1084765719 11:71307002-71307024 CACTTTAAAAAAAATGTGTTTGG - Intergenic
1085696079 11:78705807-78705829 GTGTTTAAGAAACTTGAGGTAGG - Intronic
1085882027 11:80478868-80478890 CTCTGTAAATAACTGGTGTTCGG - Intergenic
1086728336 11:90218284-90218306 CTTTTTAAGGTACTTGCGTTTGG - Intronic
1086728528 11:90219995-90220017 CAGTTTACGAAATTTGTGTTGGG - Intronic
1087722762 11:101685324-101685346 CACTTTCAGAAACTTGACTTTGG + Intronic
1089657261 11:119958889-119958911 CTTTTTAAAAAACATTTGTTAGG - Intergenic
1089875861 11:121721877-121721899 CTATTTAGGAAATTTGAGTTTGG + Intergenic
1090979046 11:131700965-131700987 AACTTTAAGAAACTTCTGTAAGG - Intronic
1093053427 12:14531371-14531393 GTCATTAAGAAAATGGTGTTAGG - Intronic
1094450738 12:30580789-30580811 TTTTTTAAGACAATTGTGTTTGG + Intergenic
1095132036 12:38554846-38554868 CTCTTTTAAAAAATTGTTTTTGG + Intergenic
1097762912 12:63489343-63489365 CTATTTAATAAATATGTGTTGGG - Intergenic
1097924008 12:65107791-65107813 CTCTTGAGGAAACTTGTTTGTGG - Intronic
1098092903 12:66923179-66923201 CTTTTTAAAAAACTTGTCTTAGG + Intergenic
1099200081 12:79666022-79666044 CTCTTTAAGAAACTTGCTTGAGG - Intronic
1099692533 12:85977020-85977042 CTCTTTACTAAACCTGTGTTTGG - Exonic
1100406318 12:94275551-94275573 CGCCTTAAGAAACTGCTGTTTGG + Intronic
1100803717 12:98259565-98259587 ACTTTTTAGAAACTTGTGTTTGG - Intergenic
1101008800 12:100428717-100428739 CGTTTTAATAAATTTGTGTTGGG + Intergenic
1101157405 12:101940750-101940772 CTCTGTAAGTCTCTTGTGTTTGG - Intronic
1101312459 12:103594825-103594847 TTCTTAAAGAAAATTGTATTTGG - Intronic
1101345355 12:103881029-103881051 CTCATAAAGATACTTGTGTGTGG - Intergenic
1102251675 12:111391570-111391592 CTCATAAAGCAACTTGTGCTGGG + Intergenic
1102725247 12:115058414-115058436 CTCTTTCTTCAACTTGTGTTTGG + Intergenic
1103078915 12:118007833-118007855 CTTTGGAAGAAACTTGGGTTTGG - Intergenic
1104375492 12:128262574-128262596 ATGTCTAGGAAACTTGTGTTAGG - Intergenic
1105670971 13:22615342-22615364 CTCTATAGAAAACTTATGTTAGG + Intergenic
1106375243 13:29180353-29180375 TTCTTTATGATACTTGTGTTTGG - Intronic
1106945608 13:34824392-34824414 CTGGTTAAGAAACATTTGTTTGG - Intergenic
1107770117 13:43780233-43780255 TTCTTTAATAAACATTTGTTGGG - Intronic
1107945074 13:45410821-45410843 AATTTTAAAAAACTTGTGTTTGG + Intronic
1108235450 13:48398601-48398623 CTCTTTAAGTAATTTGTCTGAGG + Intronic
1108945761 13:56020470-56020492 TTCTTTAAGAAATTTATGTCAGG - Intergenic
1109262051 13:60156802-60156824 TTATTTAAGCAACTTCTGTTTGG - Intronic
1110406267 13:75153850-75153872 CTAATTAAGAAATTTGTTTTAGG + Intergenic
1110897876 13:80778814-80778836 CTCTTTAAAAAAATGGTTTTGGG - Intergenic
1113467189 13:110520615-110520637 CTCTTTAAGAAACTAGGCCTGGG + Intergenic
1114232554 14:20797103-20797125 CTCTGTAAGACACTTATGTGTGG - Intergenic
1114414941 14:22536153-22536175 GGCTTTCAGAAACTTGTATTTGG + Intergenic
1115745871 14:36437032-36437054 CTCTTTAAGGAGATTGTCTTGGG + Intergenic
1117545666 14:56793187-56793209 GTCTTTATGATACTTATGTTGGG - Intergenic
1120647989 14:87096591-87096613 CTCTTTTAGGGAGTTGTGTTTGG - Intergenic
1121957757 14:98229475-98229497 CTCTTTAAGAAACTTGGAGTAGG - Intergenic
1126123319 15:45272720-45272742 CTATTGGTGAAACTTGTGTTTGG - Exonic
1127669551 15:61182375-61182397 CTCTTTCAGAAATGTGCGTTTGG + Intronic
1128861269 15:71075728-71075750 TTTTTTAAAAAACTAGTGTTTGG - Intergenic
1129814201 15:78537800-78537822 CTCTGTAAGAAGCAAGTGTTCGG - Intergenic
1131735806 15:95330886-95330908 CACTTTAAGAAGAGTGTGTTTGG - Intergenic
1131973942 15:97922305-97922327 CTTTTTAAGAAACTAGAATTTGG - Intergenic
1137375354 16:47947507-47947529 CCCTTTAACGAACTTGTGATTGG - Intergenic
1138060542 16:53885451-53885473 CTCATGAATAAAATTGTGTTGGG + Intronic
1138073731 16:54019688-54019710 CTCTTTGAGAATCTTCTGTTTGG + Intronic
1139762619 16:69198471-69198493 CTCTTTAAGGAGTTTGTGTGTGG + Intronic
1141294583 16:82755375-82755397 CTGCTTAAGCAAGTTGTGTTTGG + Intronic
1141373027 16:83504712-83504734 CCCTGTAAGCAACTGGTGTTAGG + Intronic
1146953357 17:36921537-36921559 ATCTTTATGTAACTTGAGTTAGG + Intergenic
1147938962 17:44031946-44031968 CTCTTTAAGAAACTTGGAATTGG - Intergenic
1149763041 17:59250502-59250524 CTATTTAAGAGACTTGAGGTGGG + Intronic
1151888666 17:76939185-76939207 TTTTTTAAGTAACTTGTGCTAGG - Intronic
1152869668 17:82745795-82745817 CTCTTTAAGAAACTACTGGCCGG + Intronic
1152931999 17:83114752-83114774 CTCCCTAAGAAATTTGAGTTGGG + Intergenic
1153417308 18:4861109-4861131 ATCTTTAAGAATCATGTTTTGGG - Intergenic
1153581651 18:6579989-6580011 CTCATCAAGACACTTGTCTTTGG + Intronic
1154134001 18:11760473-11760495 CTCTTAAAGACGCTTGTGTCTGG + Intronic
1156649419 18:39206827-39206849 GTAATTAAGATACTTGTGTTTGG - Intergenic
1157991895 18:52506986-52507008 CTCTTTTAGAAACTTTTTTAAGG - Intronic
1158320935 18:56263879-56263901 TTATTTAAGAAGCTTGTGTGTGG - Intergenic
1158552408 18:58447279-58447301 CTTTTTAAGAAATTTTTTTTTGG + Intergenic
1158596531 18:58821513-58821535 GCCTGTAAGAAACTTCTGTTGGG + Intergenic
1158601500 18:58859836-58859858 CCTTAAAAGAAACTTGTGTTTGG - Intergenic
1158886960 18:61837734-61837756 CCCTTTAAACAACTTGTGTGAGG + Intronic
1159681919 18:71364936-71364958 CTCTCTAAGAAACATGGGTATGG - Intergenic
1164239053 19:23367527-23367549 TTCTTTAAAAAACTACTGTTGGG - Intronic
1164285703 19:23814597-23814619 TTCTTTAAAAAACTGCTGTTGGG + Intronic
1164851437 19:31487533-31487555 CTTTTCCAGAAACTTGTGTAAGG - Intergenic
930117021 2:47726829-47726851 CTCTTTTAAAAAATTGTTTTGGG + Intronic
930457300 2:51621592-51621614 CTCCTTAATAAAGTTCTGTTGGG + Intergenic
931321514 2:61177822-61177844 CTCTTTTTGAAAGTTGGGTTGGG + Exonic
931990359 2:67783797-67783819 CTCTTTAGGAGAATTGAGTTGGG - Intergenic
932002641 2:67898741-67898763 ATCTTTAAGGAACTTGGGTGAGG - Intergenic
932507256 2:72247046-72247068 CTCTTCTAGAAAAGTGTGTTTGG - Intronic
932836229 2:75040485-75040507 CTATATGAGAAACTTTTGTTTGG - Intergenic
933086172 2:78057223-78057245 TTCTATAAGATTCTTGTGTTTGG + Intergenic
934148369 2:89118589-89118611 TTCTTCCAGAAGCTTGTGTTAGG - Intergenic
934218918 2:90063424-90063446 TTCTTCCAGAAGCTTGTGTTAGG + Intergenic
936786936 2:116104814-116104836 CTCTTTCTGAAACTTCTGTATGG + Intergenic
937518087 2:122678605-122678627 TTCTTTAAGACACTTGCCTTTGG - Intergenic
937976989 2:127588452-127588474 CTCCCTCAGAAACTTGTTTTTGG - Exonic
938002589 2:127755626-127755648 CTTTTTTAGAAATTTGTGTGTGG + Intronic
939857269 2:147374392-147374414 CTCTTCCAGATACATGTGTTTGG - Intergenic
940388080 2:153097534-153097556 ACCTTTAAGAAATATGTGTTAGG - Intergenic
941897149 2:170640482-170640504 CACTTTGAGAAACGTGTGTTGGG - Intronic
942152198 2:173087902-173087924 CTCTGTGAGAACCTTGTCTTTGG - Intronic
944800440 2:203233151-203233173 GTCTTTCAGAAACTTCTTTTGGG - Intergenic
944838795 2:203605966-203605988 CAGTTTAAGCAACTTGAGTTTGG - Intergenic
945616660 2:212078265-212078287 TTGTTTAAGAAACTTTTTTTGGG + Intronic
946448617 2:219761103-219761125 CTCTTTGAGAACCTGGTTTTAGG + Intergenic
948044462 2:234932857-234932879 CTCTTGCAGAAACTTGAGTCAGG + Intergenic
948953021 2:241267259-241267281 AAGTTTAAGAAATTTGTGTTGGG + Intronic
1169640816 20:7749937-7749959 CTCATTAAGAAATCTGTGTTAGG - Intergenic
1170224093 20:13972082-13972104 CTCTTTGTGAAACTTATCTTGGG + Intronic
1170272532 20:14544150-14544172 CTCTTTTCGAAACTATTGTTAGG + Intronic
1170989615 20:21289936-21289958 CTATTTAAGTAACATGTGTTAGG + Intergenic
1171494054 20:25542527-25542549 CTCTTTAAGAATATTCTTTTTGG - Intronic
1172866095 20:38098700-38098722 ACTTTTAAGAAAATTGTGTTTGG - Intronic
1173681383 20:44885079-44885101 CTTTTTAAAAAACCTGTGTAGGG - Intergenic
1175044036 20:56086836-56086858 TTCTTTAAGTTGCTTGTGTTTGG + Intergenic
1177438948 21:21093515-21093537 CTGTTAAAGAAAATTGTCTTTGG + Intronic
1177531661 21:22366954-22366976 TTCTTTTAGAAAATTGTTTTGGG + Intergenic
1178544490 21:33481334-33481356 CTCTTTAAGAACCTTTTGAAAGG + Intergenic
1181389901 22:22572699-22572721 CTCTTTCAGAAACTTGTTAATGG - Intergenic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
1183484136 22:38080392-38080414 ATCTTTGGGAAACTGGTGTTGGG - Intronic
1184627222 22:45744775-45744797 TTCTTTGAGATACTTGTCTTTGG + Intronic
1185024545 22:48400941-48400963 CTCTTTAAGAATCCAGTGTGAGG + Intergenic
951153582 3:19322706-19322728 TTCTTTGAGAATCTTGTATTTGG + Intronic
951695284 3:25440149-25440171 GTCAATAAGAAACTTGTTTTAGG + Intronic
951907463 3:27719602-27719624 CTCTTTAAGCAACTTTTACTGGG - Intronic
952201248 3:31130268-31130290 CTCTTTAAAAAACTTTTCTTGGG - Intergenic
952527628 3:34227752-34227774 CTCTTTCAATAAATTGTGTTGGG - Intergenic
953432285 3:42850150-42850172 CTCTATTGGAAACTAGTGTTTGG + Intronic
953465749 3:43117934-43117956 CTCCTTAAGCATCTTGGGTTGGG - Intergenic
953670457 3:44958000-44958022 CTCTTTCATATCCTTGTGTTTGG + Intronic
953775537 3:45813416-45813438 CTCTTCAAGACACTTGTCATTGG - Intergenic
954476599 3:50752160-50752182 CTTTGTAAGAAAGGTGTGTTAGG + Intronic
954542051 3:51399991-51400013 CTCCTAAAGGAAGTTGTGTTTGG - Intronic
955638190 3:61053356-61053378 CTTTTTAAAAAAATTGTGTTCGG + Intronic
955798246 3:62660143-62660165 TAATTTAAGAAACTGGTGTTAGG - Intronic
955870632 3:63434704-63434726 GGCTTTAAGAAATGTGTGTTAGG + Intronic
955914588 3:63894019-63894041 CTGCTTAAGAAATTTGGGTTTGG + Intronic
956643924 3:71438182-71438204 CTCTTTAAGAACACTGTGTCTGG + Intronic
956887649 3:73576628-73576650 CTCTTTAAGAAACTTGTGTTTGG - Intronic
957015012 3:75053177-75053199 CTGTCTAAGAAAGTTCTGTTAGG - Intergenic
957201607 3:77143148-77143170 CTGTTTAAGAAAATGGTGTCTGG - Intronic
957444419 3:80296480-80296502 CTCTTGTAGAAACTAGTGGTGGG + Intergenic
957522231 3:81333071-81333093 CTTTCTAAGTAACATGTGTTCGG + Intergenic
957595146 3:82254196-82254218 CTTTTAAAGCAACTTGTTTTTGG + Intergenic
957607814 3:82426382-82426404 CTCTTTAAGAAATTTTTGTCTGG + Intergenic
958507544 3:94999432-94999454 CTATTTAATAAAATGGTGTTGGG - Intergenic
959114178 3:102156480-102156502 CTCTTTAAGTAACCTGAGTTTGG + Intronic
959731152 3:109604132-109604154 CTGATTAATAAACTTGGGTTTGG - Intergenic
960239104 3:115319293-115319315 TTCTTTATGACACTGGTGTTAGG + Intergenic
960597945 3:119423599-119423621 CTTTTAAGGAAACTTGTTTTAGG - Intergenic
961672050 3:128540324-128540346 CTTTTTAAAAAAAGTGTGTTAGG - Intergenic
962191487 3:133315525-133315547 CTCTTTATGGAATCTGTGTTTGG - Intronic
962800528 3:138886788-138886810 CTCTGGAACAAACTTGTGTGCGG - Intergenic
964504139 3:157380079-157380101 CTTTTCAAGAAGCTTGTCTTTGG - Intronic
964631887 3:158819580-158819602 CTCCTTAGGAACCTTCTGTTTGG + Intronic
964915203 3:161832504-161832526 CTATTTATGATACTTGTGTGTGG - Intergenic
965466254 3:169034153-169034175 CTCTCTCAGACACTTGTCTTAGG + Intergenic
966441407 3:179949150-179949172 CTATTTTAAAAACTTGTTTTGGG + Intronic
967235072 3:187376330-187376352 CTCTTCAACATACTTTTGTTTGG + Intergenic
969870957 4:10104489-10104511 CTCTATCAAAAACTTGGGTTTGG + Intronic
969953546 4:10865158-10865180 CTCTTTAAGAATCTAGTCTAAGG + Intergenic
970355944 4:15252084-15252106 CTCTTTCTGAAAGTTGTTTTTGG + Intergenic
974399517 4:61385450-61385472 CTCTTTCACAAACTAGTGTGTGG + Intronic
975036293 4:69687116-69687138 TTCTTTAAGAAATTTGTAATTGG + Intergenic
975281631 4:72568829-72568851 TTCTTAAAGAAACTTATTTTGGG - Intergenic
975849174 4:78553841-78553863 CTATTTAAGAAAAATGTGTCTGG + Intronic
976316558 4:83664835-83664857 TTCTTTAAAAAATATGTGTTTGG - Intergenic
976786771 4:88830244-88830266 CTCTTTAAAAAACTAATGTATGG + Intronic
978980028 4:114933231-114933253 CTCTTCAACAAACAGGTGTTGGG + Intronic
979871865 4:125833540-125833562 CTTTTTAAAAAACTTCTCTTAGG - Intergenic
979989662 4:127361004-127361026 CTGTTTAAGAAACATTTATTTGG + Intergenic
980416998 4:132502747-132502769 CTCTTTAAAACACTCATGTTTGG + Intergenic
982015475 4:151149172-151149194 CTGGTTAAGAAACTGGTTTTTGG - Intronic
982782466 4:159505733-159505755 CTCTTAAGGAATCTTGTGGTGGG + Intergenic
983722941 4:170880848-170880870 TTCTTCAAGAAATCTGTGTTTGG + Intergenic
983874235 4:172857598-172857620 CTTTTTGAGAAAATTGTATTGGG + Intronic
983951341 4:173646360-173646382 TGCTTTAGGAAATTTGTGTTGGG + Intergenic
984132567 4:175896548-175896570 CTCTTTAAAGAAATAGTGTTGGG - Intronic
984178571 4:176451740-176451762 ATCTTTCAGAAACTACTGTTAGG + Intergenic
984185878 4:176543284-176543306 CTCTGTAAGAAACTTTACTTGGG - Intergenic
984264030 4:177474757-177474779 CTCAGAAAGAAAATTGTGTTTGG + Intergenic
985427957 4:189848324-189848346 CTTTTTAAGAAACCTGTCCTTGG - Intergenic
987868783 5:23583458-23583480 CTGTATAAGCAATTTGTGTTAGG - Intergenic
989004554 5:36795924-36795946 CTCTCTCAGAAACTTGAATTAGG - Intergenic
990808337 5:59692409-59692431 CTATTTAAGAAACTGGTTCTGGG - Intronic
991380918 5:66025350-66025372 CTCTTTTAGATACGTTTGTTAGG + Intronic
992752341 5:79872995-79873017 TATTTTAACAAACTTGTGTTTGG - Intergenic
993559233 5:89383178-89383200 CACTCTAAGAAACTGTTGTTCGG + Intergenic
996709922 5:126534238-126534260 CTCTTCAAGAAACTTTTGAAAGG - Intergenic
997047837 5:130341024-130341046 TTTTTTAAGAAACTTTAGTTGGG + Intergenic
997247310 5:132360775-132360797 CTCTTTAAAAAAATTTTTTTTGG - Intergenic
998943159 5:147307318-147307340 CTCTTTAAGAAATTTTTGTCTGG + Intronic
1000283440 5:159803243-159803265 CTCTATAAGAAATATGTTTTTGG - Intergenic
1000399288 5:160808809-160808831 CTCTTTAAGTCACTTGTTTTGGG - Intronic
1001349849 5:170950005-170950027 CTCTTTAATAAAATGGTGCTGGG + Intronic
1001887117 5:175302885-175302907 CTCCTTAATAAACATTTGTTTGG - Intergenic
1004023920 6:11800364-11800386 CTCTTTTAAAAAATTGTTTTGGG + Intronic
1004833478 6:19503306-19503328 CTCTTTAAAAAAATAGCGTTGGG - Intergenic
1004965531 6:20845963-20845985 CTCTTTCAGAAACATTTGCTTGG - Intronic
1006189832 6:32201069-32201091 CTCTTAAAAAAACTGGTGTCTGG + Intronic
1006231307 6:32589445-32589467 CTCTTCATGAGACTTGTGTAAGG - Intronic
1006305272 6:33214847-33214869 CTGTTTAAGAAACTGGAGATGGG + Intergenic
1007144823 6:39617873-39617895 TTATTTAAGTGACTTGTGTTGGG - Intronic
1008153026 6:47978315-47978337 CTCTGTAATAAACTGGTGTGAGG - Intronic
1008798660 6:55339559-55339581 CTATTTAAAAAACTTCTTTTTGG - Intronic
1009730383 6:67595470-67595492 CTCTTTAAGTATTTTATGTTCGG + Intergenic
1011471567 6:87713037-87713059 CTCTTTAAAAAAATTTTTTTAGG + Intergenic
1011475020 6:87743007-87743029 ATCTTTTAAAAACTTGTGTTAGG - Intergenic
1012053422 6:94373380-94373402 CTACGTAAGAAAATTGTGTTTGG + Intergenic
1012294607 6:97505441-97505463 CTATTTAATAAAATTGTGCTGGG + Intergenic
1012833793 6:104239713-104239735 CTGTTTAAGAAATCTTTGTTGGG - Intergenic
1013612225 6:111806169-111806191 CTTTTTAACCAGCTTGTGTTCGG + Intronic
1013680087 6:112515591-112515613 ATATTTAAGTAACTTGTGTAAGG + Intergenic
1015241136 6:131024878-131024900 CTCTTTAATACACTTTTATTTGG + Intronic
1015737635 6:136417875-136417897 CTCTTTTAAAGACTTGTGTTGGG + Intronic
1016310983 6:142733410-142733432 CTTTTTAAGAAACTTTTATTTGG - Intergenic
1016503568 6:144750502-144750524 CTCTTTAAGAGACTAGAGTCAGG - Intronic
1017216495 6:151913282-151913304 CTCTTTAGGACACTTGTATTGGG + Intronic
1018280971 6:162185053-162185075 ATCGTTATGAAACTTGTATTGGG + Intronic
1020917989 7:14222084-14222106 CTTTTAAAAAAACTTGTTTTTGG + Intronic
1022519316 7:30995593-30995615 AGCTTTAAAAATCTTGTGTTTGG + Intergenic
1022833597 7:34092688-34092710 CTTTTTAAGATCCTTGTTTTGGG - Intronic
1023268928 7:38438466-38438488 CTAATTAAGAAACTTGGGTCTGG - Intronic
1024514104 7:50229469-50229491 CTATTTAAGGAAATTTTGTTAGG + Intergenic
1026486149 7:70823232-70823254 CTTTTTAGTAAAATTGTGTTCGG - Intergenic
1028164055 7:87517699-87517721 CTCTGTAAGAAACTTTCTTTTGG - Intronic
1028313617 7:89370973-89370995 CTGTTTAACAAACTTTTGTTAGG + Intergenic
1028619912 7:92813830-92813852 CTCATTGAGAAACTTTGGTTGGG - Intronic
1029445222 7:100608150-100608172 CTCATTAAGAAACATTTATTTGG - Exonic
1032145546 7:129376394-129376416 GTCTTAAAGAAACTTGAATTCGG + Intronic
1034137613 7:148785773-148785795 CTCTTTAATGAGCGTGTGTTGGG + Intronic
1034185939 7:149177194-149177216 CTCTTGAAAAAACTTATGCTAGG + Intronic
1035601537 8:900016-900038 GTCTTTAAGACCTTTGTGTTTGG + Intergenic
1035877262 8:3204626-3204648 ATGTGTAAGAAACTTGTGTGTGG - Intronic
1035916755 8:3633066-3633088 CTATTTAATAAATTAGTGTTGGG - Intronic
1036043286 8:5110338-5110360 TTCTTCAAGTAACTTTTGTTAGG - Intergenic
1036156888 8:6350448-6350470 CTCTTTAAGAAACAGGAGATAGG + Intergenic
1037510667 8:19578668-19578690 CTTTTTAAGAAACTTGGTATAGG - Intronic
1037782817 8:21882334-21882356 CTTTTTAAGAATCATGTGCTGGG - Intergenic
1043058197 8:75466928-75466950 CACTTTAGGAATCTTGAGTTAGG - Intronic
1043499910 8:80842665-80842687 CTCTTTTAAAAGCTTCTGTTTGG + Intronic
1043981538 8:86646727-86646749 CCCTTTAAGAAGGTTGTTTTTGG + Intronic
1044912187 8:97072044-97072066 GAGTTTAAGAAACTTGTTTTAGG - Intronic
1045946018 8:107797097-107797119 TTCTTTAAGAAACTAATTTTTGG - Intergenic
1046267436 8:111848509-111848531 TTCTTTAATAAAATTGTGCTGGG - Intergenic
1046751976 8:117935697-117935719 ATATTTAAGAAAGTTGAGTTTGG - Intronic
1046779828 8:118203112-118203134 CTCAATAAGAAACATTTGTTGGG + Intronic
1047572854 8:126119563-126119585 CTCTTCAATAAAATGGTGTTGGG - Intergenic
1048245117 8:132787333-132787355 CTCTTTTAGAACCTTGTGGCAGG - Intronic
1048600456 8:135914119-135914141 CTTTTTAAAAAACTTGTCATAGG - Intergenic
1048970062 8:139640431-139640453 CTCTTGAAGAAAGTAGTGTGGGG - Intronic
1050382870 9:5049159-5049181 CTCTTTAAGAGGCTGGTGTATGG - Intronic
1051319008 9:15879558-15879580 CTCTTTAACCAACTTCTCTTGGG + Intronic
1052112229 9:24600723-24600745 CTCTTTGAGAAAATTGAGCTGGG - Intergenic
1053169497 9:35868703-35868725 CTATTTAAGAAACTTGTGCAGGG + Intergenic
1054867251 9:70015041-70015063 TTATTTAAGAAATTTATGTTAGG - Intergenic
1055520431 9:77075259-77075281 CCCTTTCTGAAACTTTTGTTTGG + Intergenic
1056523304 9:87419945-87419967 CTTTTTAATAAACTTCTCTTTGG - Intergenic
1056928793 9:90857733-90857755 CTCTTTGAGAAACCACTGTTGGG + Intronic
1058293307 9:103272328-103272350 CTCCTTAAAAAACCAGTGTTGGG - Intergenic
1058412875 9:104752788-104752810 CCATATAAGAACCTTGTGTTAGG - Intronic
1058942845 9:109830275-109830297 CTCTCTAAGAAAGTTGCATTTGG - Intronic
1059028337 9:110661719-110661741 CTCTTCAATAAAATTGTGTTGGG + Intergenic
1059288528 9:113199818-113199840 CTCTTTCAGAATCATGTGCTGGG - Exonic
1059358724 9:113722029-113722051 CTCTTTTACAAAATTGTTTTAGG - Intergenic
1060678547 9:125539781-125539803 CTATTTAAGAAAATTGTAATTGG - Intronic
1061239315 9:129360084-129360106 CTCTTTGAGGGACTTTTGTTTGG - Intergenic
1187685421 X:21811125-21811147 CTCTTTCCGGAAATTGTGTTGGG - Intergenic
1187819512 X:23271770-23271792 CTCATTAAGAATCATGTATTTGG - Intergenic
1189093722 X:38115182-38115204 CTCTTTAAGATACTTATTTCAGG + Intronic
1189191232 X:39108345-39108367 CTCTTTAAAAAAATGGTATTGGG - Intergenic
1191054860 X:56231573-56231595 CTCTTTAAAAGAATTGTGGTAGG + Intergenic
1191665492 X:63698197-63698219 GTGTTTAAGACACATGTGTTAGG - Intronic
1193485716 X:82083835-82083857 CTCTTTAAGAAAATCCTTTTAGG + Intergenic
1194033662 X:88845379-88845401 CTATTTATCAAACTTATGTTGGG - Intergenic
1195164656 X:102207299-102207321 CTCTTGAAGAAAGTTGTTTGGGG - Intergenic
1195194202 X:102479792-102479814 CTCTTGAAGAAAGTTGTTTGGGG + Intergenic
1196050999 X:111304039-111304061 TTTTCTAAGAAACTTTTGTTTGG - Intronic
1197263898 X:124346371-124346393 CTCTGTATGAACCCTGTGTTGGG + Exonic
1198429089 X:136547942-136547964 CACTTTAAAAAGCTGGTGTTTGG + Intronic
1199266734 X:145836866-145836888 CTTTTTAAGAAATGTGTATTCGG + Intergenic
1199350273 X:146792277-146792299 ATCCTTAATAATCTTGTGTTTGG - Intergenic
1199350275 X:146792316-146792338 CTTTTTAAGAATTTTGGGTTTGG - Intergenic
1199922454 X:152422705-152422727 ATCTTTAAGAATATTGTGTTGGG - Intronic
1201900615 Y:19043726-19043748 TCATTTAAGAAACATGTGTTGGG + Intergenic