ID: 956888782

View in Genome Browser
Species Human (GRCh38)
Location 3:73588531-73588553
Sequence GTGGGAAACAGGACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 504}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956888782 Original CRISPR GTGGGAAACAGGACTGAGGA GGG (reversed) Intronic
900178158 1:1299722-1299744 GTGGGAGACAGGCAGGAGGAAGG + Intronic
900552060 1:3261772-3261794 GTGGGGACCAGGACGGAGGGCGG - Intronic
900637651 1:3673877-3673899 GTGGGAACACGGACTGGGGAGGG + Intronic
900648607 1:3720283-3720305 GTTTTAAACAGGACTGGGGATGG + Intronic
901167419 1:7230271-7230293 CTGGGAAGCAGGAATGAGGCCGG + Intronic
901752848 1:11422112-11422134 GTGGGAGGCAGGAGTGAGGAAGG - Intergenic
901763874 1:11487915-11487937 GTGTGACACAGGAGAGAGGATGG - Intronic
902191717 1:14767867-14767889 GTGGAATACAGGACTGCAGAGGG + Intronic
902631147 1:17705486-17705508 GAGGGAAGGAGGACTGAGGGAGG + Intergenic
902728039 1:18350274-18350296 GTGGGGAGCAGGAGTGAGGGTGG + Intronic
902800816 1:18828911-18828933 CTGGGAGAAAGGACTGAGAATGG + Intergenic
904286731 1:29457700-29457722 GTGGAAGACAGGGCTGAGAAGGG - Intergenic
904368487 1:30033779-30033801 GTGGGGAATAAGACAGAGGAGGG + Intergenic
904767810 1:32863836-32863858 GCTGGAAACAGGACAGAAGAAGG + Exonic
904872161 1:33625614-33625636 GGGGAAAACAGGACAGAGGCAGG - Intronic
905389462 1:37626846-37626868 GTGGGAATGAGGGCTCAGGAAGG + Intronic
905458709 1:38106716-38106738 TTGGGAAACAGCTCTGATGATGG + Intergenic
905651180 1:39658032-39658054 GTGGGGAACGGGACAGAGCATGG - Intergenic
905898436 1:41564551-41564573 GAAGGCAACAGGACTGAGAATGG + Intronic
905976743 1:42181032-42181054 GTGGCAGACAGCAGTGAGGAAGG - Intronic
906324322 1:44835019-44835041 GGAGGAAATAGGACAGAGGAGGG + Intronic
906681963 1:47733232-47733254 GTGGGAGTCAGGAGAGAGGATGG - Intergenic
907273956 1:53306724-53306746 GTGGGACCCAGGACAGAGGCAGG - Intronic
907543707 1:55240496-55240518 GTGGGAAGGAGGACTGGTGAAGG - Intergenic
908089899 1:60674970-60674992 GAGGGACACAGGAGTGAGGGTGG + Intergenic
908090152 1:60677321-60677343 GAGGGACACAGGAGTGAGGATGG + Intergenic
909443738 1:75724914-75724936 GTGGGAAGTCGGGCTGAGGAAGG + Intronic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911497091 1:98644859-98644881 GTGAGAACCAGGACTGCTGATGG - Intergenic
914320833 1:146557969-146557991 GAGGAATACAGGACTCAGGAAGG + Intergenic
915218220 1:154353870-154353892 GTGGGAAGAAGAACAGAGGAAGG - Intergenic
915308284 1:154993585-154993607 GTGGGCAACAGTTCCGAGGAAGG - Exonic
915400133 1:155616067-155616089 TGAGGAAACAGGACTCAGGAAGG + Intergenic
915417339 1:155752262-155752284 TGAGGAAACAGGACTCAGGAAGG + Exonic
915632421 1:157162783-157162805 GAAGTAAACAGGATTGAGGAGGG - Intergenic
915934216 1:160081432-160081454 GTGGTACCCAGGACTGGGGAGGG + Intergenic
916635377 1:166662437-166662459 GTATAAAAGAGGACTGAGGATGG + Intergenic
917445440 1:175102649-175102671 GTGGGAACCAGGGCTGCGCATGG - Intronic
917602827 1:176594829-176594851 GGGGGAGACAGCTCTGAGGATGG + Exonic
919117918 1:193304551-193304573 ATGGCAGACAGGACTGAAGAGGG - Intergenic
920004768 1:202825063-202825085 GTGGGAAATAAGAGGGAGGAAGG + Intronic
920211374 1:204331307-204331329 GTGGGAAACAGGAAGAAGAAAGG + Intronic
920684626 1:208099992-208100014 GTAGGTAACAGGTCTGAGGTTGG - Intronic
920703043 1:208232117-208232139 GTGGGAAGGAGGGCTGGGGAGGG + Intronic
920740207 1:208574812-208574834 GTGTCAAACAGCACTTAGGATGG + Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
920872393 1:209805520-209805542 TTGGGAAACTGGAGTGAGGGTGG - Intronic
920874671 1:209822953-209822975 GTGGGGAACTGCACAGAGGATGG - Intergenic
921883362 1:220278516-220278538 GTAGGAAACAGGAAAGGGGAAGG - Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922470137 1:225871633-225871655 CTGGGAAACAGGGCTGGAGAGGG + Intronic
924217572 1:241839849-241839871 CTGGAAAACAGGGCTGGGGAAGG - Intergenic
924451512 1:244182921-244182943 CTGAGAAATAGGAGTGAGGATGG + Intergenic
1063434661 10:6020211-6020233 ATGGAAACCAGGACTGGGGAGGG - Intronic
1063552308 10:7044707-7044729 CTAGGAAACAGGCCTAAGGAGGG + Intergenic
1064282981 10:13968199-13968221 CTGGGAGTCAGGACTGAGTATGG + Intronic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1065101243 10:22335079-22335101 CTGGGTGACAGGGCTGAGGAGGG + Intergenic
1065424659 10:25587060-25587082 GTGGAAAACAGGAATTAGGGAGG + Intronic
1065813165 10:29461003-29461025 GTGGGAAACAGGAATTAGGGAGG - Intronic
1066660871 10:37737387-37737409 GTGGGAACCAGGGCTGCGCATGG + Intergenic
1067474493 10:46556812-46556834 GTGGGGACCCGGCCTGAGGAGGG - Intergenic
1067731232 10:48812890-48812912 GTGGGAAAGAGGAGTGAGTAAGG - Intronic
1067789028 10:49273565-49273587 GTGAGAAACAAGACTGAGTGAGG - Intergenic
1067922378 10:50472911-50472933 GTGGGGAGCAGGATAGAGGAAGG - Intronic
1068579186 10:58719950-58719972 GTCTGAAACAAGACTGAGAAAGG + Intronic
1068610337 10:59053053-59053075 ATGGGAATCTGGACTGAAGATGG - Intergenic
1070275218 10:74999441-74999463 TAGGGAAACAGGGCTGAGGGTGG + Intronic
1070965785 10:80529463-80529485 GTGGGAAGCAGACCTCAGGAAGG + Exonic
1071718489 10:88120131-88120153 GGGGGAAGCAGGAGCGAGGAGGG + Intergenic
1071915589 10:90291490-90291512 GTGGGAAACAAGACTCAGAGAGG + Intergenic
1071934081 10:90507310-90507332 GTGGAAAAGAGGCATGAGGAAGG + Intergenic
1071992518 10:91113824-91113846 GTGGCAAACGGGACTTAGAAGGG + Intergenic
1072501513 10:96022900-96022922 ATGAGAAACATGAGTGAGGAAGG + Intronic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1073530965 10:104231956-104231978 GTGGGAAAGACAACTGGGGACGG + Intronic
1073570359 10:104576180-104576202 GTGGGAACCAAGCCTGAGCAAGG - Intergenic
1073911221 10:108347054-108347076 GAGGGAAAGAGGAGGGAGGAAGG + Intergenic
1074495473 10:113976562-113976584 GTGGGCATCAGACCTGAGGATGG + Intergenic
1074495614 10:113977837-113977859 ATGGGAAAGAGGAGTGAGGTGGG - Intergenic
1074899824 10:117806362-117806384 GTGGGATACGTGACTGAGGCTGG + Intergenic
1075409837 10:122219236-122219258 GTGTGAAACAGGGATGAGGTGGG - Intronic
1075503059 10:122995763-122995785 GAGGGAAACACGGCTAAGGAAGG + Intronic
1075882943 10:125870125-125870147 GGGGGAATCAGGAGTTAGGAGGG + Intronic
1076659366 10:132045112-132045134 GTGGGAACCTGAACTGAGGCAGG - Intergenic
1077147774 11:1053598-1053620 GTGGCTGAGAGGACTGAGGACGG + Intergenic
1077503136 11:2918165-2918187 GTGGGGCACAGGCCAGAGGAAGG - Intronic
1077718010 11:4600622-4600644 GTGGGAGACAGGTCTGAGTGGGG - Exonic
1077866509 11:6226019-6226041 GTGAGAGACAGTACTGATGAGGG - Intronic
1079282483 11:19099876-19099898 GCAGAAAAGAGGACTGAGGAGGG - Intergenic
1079392517 11:20034964-20034986 GTGCAAAACAGGACTGGGGTAGG + Intronic
1080101973 11:28470213-28470235 GGGGGTAAGAGGACTGAGCAAGG - Intergenic
1080876602 11:36280286-36280308 GTGGGACAGAGGGGTGAGGAGGG + Intronic
1081220567 11:40455319-40455341 CAGGGACACAGGAGTGAGGATGG - Intronic
1083369475 11:62166836-62166858 ATGGGAAACAGGAGGCAGGAGGG + Intergenic
1083778037 11:64903664-64903686 GGGGGGAACAGGGCTGAGAAGGG + Intronic
1084021867 11:66422571-66422593 GTGGGAAATTGGACCGAGGAAGG - Intronic
1084063489 11:66690338-66690360 GTGGCAGCCAGGACTGAGGCAGG - Intronic
1084443851 11:69192011-69192033 GTGGCAAACTGGGATGAGGATGG + Intergenic
1084962777 11:72726052-72726074 AGGGGAAACAGTTCTGAGGAGGG + Intronic
1085032405 11:73280724-73280746 GGTGGAAACAGCACTGACGAGGG + Intronic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1085199470 11:74692969-74692991 AGGAGAAACAGGAGTGAGGATGG - Intergenic
1085508018 11:77071166-77071188 GGGGGAAACAGGACTGTGACTGG - Intronic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088480590 11:110293266-110293288 ATGGAAAACAGGACTGGGAAAGG + Intronic
1088900649 11:114114310-114114332 GAGGGAAACCTGACTGGGGAGGG + Intronic
1089460512 11:118650419-118650441 GTAGGAAGCAGGAGTAAGGAAGG - Intronic
1090282209 11:125465810-125465832 GTGGGAACCAGGCCTAGGGAGGG - Intronic
1091329907 11:134724246-134724268 GTGGGAAGCAGGGCTGTGAATGG - Intergenic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091797765 12:3306992-3307014 GTGGGAAACAGGGCAGAAGATGG + Intergenic
1091831067 12:3551516-3551538 GTGGGGGACAGGGCTGAGCATGG + Intronic
1092726292 12:11488713-11488735 GACTAAAACAGGACTGAGGATGG + Intronic
1093426822 12:19037112-19037134 CTGGAAAACAGGAATTAGGAAGG + Intergenic
1093477806 12:19574251-19574273 GGGGGCAACAGGAGAGAGGATGG + Intronic
1093551162 12:20413419-20413441 GTGGAAAAGTGGGCTGAGGAAGG + Intronic
1095262116 12:40108754-40108776 GTGGGAAAGACGATTGAGAAGGG - Intergenic
1095485607 12:42681257-42681279 CTGAGGAACAGGACTGGGGAAGG - Intergenic
1097009337 12:55941125-55941147 GAGGGAAACAGGAGGGAGGGGGG + Intronic
1097635406 12:62115649-62115671 GTGGGAAGCAGGACTGTGGGAGG - Intronic
1097942406 12:65325768-65325790 GTGGGAAAGAGGCCTGCAGATGG - Intronic
1098150885 12:67545121-67545143 GTGGGAAAGGGGACAGAGAAGGG + Intergenic
1098205517 12:68105243-68105265 CTGGGTAACAGGACAGAGAAGGG - Intergenic
1100715075 12:97296827-97296849 GAGGGAAACAGGATTGGAGAAGG + Intergenic
1100817007 12:98396394-98396416 GTAGGAAGCAGGAAGGAGGATGG - Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1101830851 12:108255311-108255333 GTGGGAGACAAGAGGGAGGAAGG + Intergenic
1103340912 12:120220759-120220781 GTGGGAGACAGGAGTGTGGCTGG - Intronic
1104223211 12:126806249-126806271 GTGGTCACCAGGAGTGAGGAAGG - Intergenic
1104682770 12:130762626-130762648 GTGAGAAGGAGGGCTGAGGACGG + Intergenic
1105402117 13:20105150-20105172 GTGAGCAGCTGGACTGAGGACGG - Intergenic
1105970360 13:25424096-25424118 GTGGGAAATAGAGCTGAGAAGGG + Intronic
1106169190 13:27274199-27274221 GAGAAAAACAGGAGTGAGGATGG - Intergenic
1106485232 13:30166611-30166633 GTGGGAGACAAGGCTGAGGAGGG + Intergenic
1107431931 13:40348076-40348098 GAGGGAAACAGATCTGAGCAGGG + Intergenic
1108223646 13:48265222-48265244 TTGGGGAATGGGACTGAGGAAGG - Exonic
1108756128 13:53504554-53504576 TTGGGTAATAGGACTGAGGCAGG - Intergenic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1112421730 13:99257465-99257487 GTGGGAAAAAAGACTCAAGATGG - Intronic
1113330212 13:109319409-109319431 GTGGGAACCAGGGCTGCGCACGG - Intergenic
1113937653 13:114002925-114002947 CTGGGACACAGGACTGGGGACGG - Intronic
1114502823 14:23183731-23183753 GGAGGAGACGGGACTGAGGATGG - Intergenic
1118753005 14:68820094-68820116 GTGGGAATCGGGTATGAGGATGG + Intergenic
1121230206 14:92352033-92352055 GTAGTAAACAGAAATGAGGAAGG + Intronic
1121328173 14:93033931-93033953 GTGGGACTGGGGACTGAGGATGG + Intronic
1121519914 14:94578982-94579004 GAAGGAATCAGGACTGAGGGTGG - Intronic
1121695235 14:95907126-95907148 GTGGCAAAAAGGAAGGAGGAAGG - Intergenic
1121891790 14:97601385-97601407 GTGGGAAACACGACGAGGGAAGG + Intergenic
1121980044 14:98446764-98446786 GTGGGAAGCAGGACCAAGCATGG + Intergenic
1122441738 14:101736797-101736819 GTGGGAGAGAGGACAGAGCAGGG + Intergenic
1123145454 14:106125520-106125542 GGGAGAAACAGGACTGGGGGTGG - Intergenic
1123860669 15:24463072-24463094 AAGAGAAACAGGACTGAGGCGGG + Intergenic
1126217433 15:46172399-46172421 GTGGCCTAGAGGACTGAGGAAGG + Intergenic
1126495402 15:49284491-49284513 GTTGGAGAGAGGACTGAGGCTGG + Intronic
1126725610 15:51628606-51628628 TAGGGAAACAGGATGGAGGAAGG - Intergenic
1127247531 15:57193942-57193964 GTAGGAAACAAGACTGGAGATGG - Intronic
1127261673 15:57331296-57331318 GTGGGAAGCAGGACCATGGATGG + Intergenic
1127488108 15:59437955-59437977 GTGGGAACGAGGAGGGAGGAGGG + Intronic
1127611909 15:60645301-60645323 GTGGCAAAAAGGACAAAGGAGGG + Intronic
1128224857 15:65994513-65994535 GTGGGAAAGAGGAGTGAGAGAGG + Intronic
1128326242 15:66725952-66725974 GTGGGCAGGAGGACTGAGGAAGG - Intronic
1128419972 15:67482771-67482793 GTGGGAAACGGGCCTGAGTAGGG + Intronic
1128775853 15:70319796-70319818 GAGGGAAGGAGGACTGAAGAGGG - Intergenic
1129244426 15:74270944-74270966 GGGTGACAGAGGACTGAGGAGGG + Intronic
1130091749 15:80827000-80827022 ATAAGAAGCAGGACTGAGGATGG + Intronic
1131593547 15:93773912-93773934 GTGGGAGGCAGGGCTGAGGCTGG - Intergenic
1131654238 15:94438393-94438415 GAGAGGAATAGGACTGAGGAAGG + Intronic
1131950458 15:97675649-97675671 TTGGGAAACAGTACTGGGGTAGG - Intergenic
1132639622 16:971607-971629 GGGGGACTCAGGACTCAGGAGGG + Intronic
1132903548 16:2271019-2271041 CTGGGACACAGGGATGAGGATGG + Intergenic
1132936316 16:2483087-2483109 GTGAGAGCCAGGACTGAGGGGGG + Intronic
1133326901 16:4947420-4947442 GTGGGAGACAGGAGTGGGAATGG + Intronic
1133419245 16:5631639-5631661 GTGGGAAACATGAATGCAGAAGG - Intergenic
1133539139 16:6731789-6731811 GTAGGAAACAGCAGTGGGGAAGG - Intronic
1134071952 16:11265758-11265780 TTGCGAAAGAGGAATGAGGAAGG + Intronic
1135544544 16:23356930-23356952 GTGGGAAGGAGGCCTGAGGATGG + Intronic
1135740043 16:24967428-24967450 GCAGGAAACAGGACTGAGGCTGG + Intronic
1135778823 16:25280714-25280736 GGGGGAGACAGTAGTGAGGAGGG + Intergenic
1135945415 16:26860625-26860647 GTGGTCAACAGGAATGAGGGAGG + Intergenic
1136230807 16:28884150-28884172 TTGGGAGACAGGAGTGAGAAAGG - Intronic
1136505815 16:30702522-30702544 GTGGAAAACAGGGCTGGGCACGG - Intronic
1136693655 16:32056263-32056285 GGGAGAAACAGGACTGGGGGTGG + Intergenic
1136794145 16:32999498-32999520 GGGAGAAACAGGACTGGGGGTGG + Intergenic
1137238563 16:46635324-46635346 GTTGGGAACAGGAAGGAGGAAGG + Intergenic
1137438295 16:48476501-48476523 GTGGGAACCAGAACTGAGGTAGG - Intergenic
1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG + Intronic
1139512685 16:67436387-67436409 GTGGGAATCAGGGCTGGGGGTGG + Intronic
1139905848 16:70365444-70365466 GGGATTAACAGGACTGAGGATGG + Intronic
1140012700 16:71152138-71152160 GAGGAATACAGGACTCAGGAAGG - Intronic
1140472900 16:75225041-75225063 GTGGGAGAGGGGACTAAGGAAGG - Intergenic
1140725455 16:77807530-77807552 GAGGGAAGCTGGACTGGGGACGG - Intronic
1142028096 16:87825065-87825087 GTGGGAAACAGAAGGAAGGAGGG - Intergenic
1142134846 16:88447057-88447079 GCTGAAAACAGGACTGACGACGG + Intergenic
1142153067 16:88521188-88521210 GTGGGAAACAGCACAGAGGAGGG - Intronic
1142329833 16:89444702-89444724 TTGGAAAACAGGAAGGAGGATGG + Intronic
1203096409 16_KI270728v1_random:1261179-1261201 GGGAGAAACAGGACTGGGGGTGG + Intergenic
1142875456 17:2849585-2849607 GTGGGAATCAGGCCTGGGGCGGG - Intronic
1143502990 17:7349820-7349842 GTGGTAATCAGGAGTGTGGAAGG - Intronic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144170613 17:12656451-12656473 GTATGCAACAGGAGTGAGGAAGG - Intergenic
1144794029 17:17878920-17878942 CTGGGAAACAGGCCTGAGGTGGG + Intronic
1145056452 17:19706804-19706826 GTGGGGAGCAGGAATGAGGTGGG - Intronic
1145242902 17:21250037-21250059 GTGGGGACCAGGACAGAGCAGGG - Intronic
1146220735 17:31017463-31017485 ATGGGAATCAGGAATGAGAAAGG - Intergenic
1146687905 17:34853951-34853973 GTGAGACACAGGCCTGGGGAGGG - Intergenic
1146757158 17:35442980-35443002 GTGGTAAACAGACCTAAGGAAGG + Intronic
1147160803 17:38568474-38568496 GTGGGAAAAGGCACAGAGGATGG + Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148765442 17:50036062-50036084 CTGGGAGACAGGACTCAGTATGG - Intergenic
1148863653 17:50617710-50617732 GCTGGAGACAGGGCTGAGGATGG + Intronic
1149051513 17:52310618-52310640 CTGGGTAACAGGTCTGAGGTTGG - Intergenic
1149651400 17:58278637-58278659 GGCGGAAACAGGACTGAGCATGG + Intronic
1150367039 17:64597899-64597921 ATGGGAATCAGGAATGAGAATGG + Intronic
1150632019 17:66886439-66886461 GTGGGAAACCGGAGCCAGGAGGG + Intergenic
1151380707 17:73723975-73723997 AGGGGACACAGGGCTGAGGAAGG - Intergenic
1151440933 17:74128695-74128717 GTGGGACACAGGAGTGTGGATGG + Intergenic
1151550456 17:74819721-74819743 GATGGAAACAAGAGTGAGGAGGG - Intronic
1151550653 17:74820750-74820772 GTGGGAAACGGGGCTGGGGAAGG - Intronic
1152492453 17:80646431-80646453 GTGGGTTACAGGACAGAGGGAGG + Intronic
1152977087 18:231700-231722 GAGGGAAATAGGAGTGGGGAGGG - Intronic
1153269975 18:3310748-3310770 GTGGAAAAGAGGAGTGAGGGAGG + Intergenic
1153369192 18:4294832-4294854 ATGGGAAACTGGACAGGGGATGG + Intronic
1153378061 18:4403918-4403940 GTGGGAAAAAGGGCTGCAGAAGG - Intronic
1153584340 18:6605781-6605803 GGGGTAAGCAGAACTGAGGATGG + Intergenic
1153746590 18:8185907-8185929 CTGGGGAACAGGACTGTGTATGG - Intronic
1154076202 18:11204163-11204185 CTGGGAGACAGGAATGAAGAGGG + Intergenic
1155115997 18:22767588-22767610 GAAGGCAGCAGGACTGAGGATGG - Intergenic
1156498824 18:37544001-37544023 GGGGGAAGCAGGAGTGAAGAGGG + Intronic
1156988585 18:43379110-43379132 ATGGTAAACAGGAATTAGGAAGG - Intergenic
1157038418 18:44006609-44006631 GAGGGAAACAGAAGAGAGGAAGG + Intergenic
1157197004 18:45627610-45627632 GTGGGAAGGGGCACTGAGGAAGG + Intronic
1157369643 18:47099048-47099070 GTGAGAAAGAGAACTGAGGGAGG - Intronic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157598558 18:48878632-48878654 GTGGGGAACAATACTGAGAAAGG + Intergenic
1157623306 18:49028315-49028337 GTGGGAAACAGGCCTGGGCATGG + Intergenic
1158935571 18:62361461-62361483 GAGTGAAACCGGACTGAGCAGGG + Intronic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1159215974 18:65390932-65390954 GAGGGAACCAGTCCTGAGGAAGG - Intergenic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1160050244 18:75426704-75426726 GTGGGGATCAAGACAGAGGAAGG + Intronic
1160336817 18:78049200-78049222 GCTGAAAACAGGACTGAGCATGG - Intergenic
1162299178 19:9834719-9834741 GTGGGAAACAGGTGGGAAGAGGG + Intergenic
1162897982 19:13776765-13776787 AGAGGAAACAGGAGTGAGGAGGG - Intronic
1163287457 19:16357534-16357556 GCGGGAAGCAGGAGAGAGGAGGG + Intronic
1163686370 19:18714135-18714157 ATGGGATACAGGGCTGTGGAGGG - Intronic
1163827012 19:19529444-19529466 GGAGGAAACAGGCCTGGGGAAGG + Exonic
1164596470 19:29533656-29533678 GTGGGACACAAGACTGAGCATGG - Intronic
1164930152 19:32169063-32169085 CTGGGAAACAGCACAAAGGATGG + Intergenic
1165075358 19:33277329-33277351 GTGACAAACAGGGCTGGGGAGGG + Intergenic
1166167411 19:41001412-41001434 GTGTGCATCAGGGCTGAGGAAGG + Intronic
1166347012 19:42172818-42172840 CTGGGAGACAGGTCTGTGGATGG + Intronic
1166530871 19:43542823-43542845 GAGGGAATCAGGGCAGAGGATGG - Intergenic
1166686708 19:44800705-44800727 GTGGGGACCAGGCCTGGGGACGG - Intergenic
1166867175 19:45846721-45846743 CTGGAAAGCAGGACTGAGGGAGG + Intronic
1167673342 19:50869147-50869169 GTGGGCAGTAAGACTGAGGAAGG - Intronic
1167780361 19:51594908-51594930 GTTGTAACCAGGACAGAGGAGGG - Intergenic
1168126805 19:54288495-54288517 GTGGGAAACATGACTGTGGGGGG + Intergenic
1168277492 19:55285597-55285619 GTGGGAAACAGGATGGAGGGTGG + Intronic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168407540 19:56118779-56118801 CTGTGAAACATGTCTGAGGATGG + Intronic
1168479820 19:56710268-56710290 GGAGGACACAGGACTCAGGAAGG - Intergenic
925172632 2:1759644-1759666 GTGGGAACCCGGGCTGTGGAAGG - Intergenic
926608218 2:14918754-14918776 GTGGGAAACAGGAATAGAGAAGG + Intergenic
927318868 2:21719797-21719819 GTGGGCAAAAGGACTGAATAGGG - Intergenic
927920565 2:26969403-26969425 ATGGGAATCAGGGCTGAGGGAGG + Intergenic
928371492 2:30743113-30743135 GTGGCAAGAGGGACTGAGGAAGG - Intronic
928914986 2:36461025-36461047 CTGGGAAACAGAATTGAGAAAGG + Intronic
929667487 2:43844482-43844504 GTGGGAGACAGGAGAGATGAGGG - Intronic
930097709 2:47579367-47579389 CTAGGAAGCATGACTGAGGAAGG - Intergenic
930724604 2:54670497-54670519 GTGGGAAGCAGGGGAGAGGATGG - Intronic
931051540 2:58420356-58420378 GTGAGAAACTGGGCAGAGGATGG - Intergenic
931102835 2:59021536-59021558 GTGTGTAACAGTACTGAGAAGGG - Intergenic
931591586 2:63889349-63889371 GAGGGAAAAAAGACTGAAGAGGG + Intronic
932245075 2:70190033-70190055 TTGGGAAACAGAAGTTAGGAGGG + Intronic
932598766 2:73110463-73110485 GGGGGGAACAGGAGTGGGGAGGG - Intronic
932834195 2:75020213-75020235 GTGGGAGCAAGGGCTGAGGATGG - Intergenic
933516411 2:83309320-83309342 GAGGGAAACAATAGTGAGGAGGG - Intergenic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
935790279 2:106584431-106584453 GCGGGAACCGGGACTGAGGGCGG + Intergenic
936404404 2:112189283-112189305 GTGGGAAGCAGGTTTGATGACGG - Intergenic
937895696 2:126975385-126975407 TGGGGAAACAGGACTTAGGAGGG - Intergenic
938173178 2:129101053-129101075 GAGGGAAACAGGGCAGAGCAGGG - Intergenic
938241049 2:129742530-129742552 GTGTGAGAAAGGATTGAGGAGGG - Intergenic
938757900 2:134397530-134397552 ATGGCAAACAGGACACAGGAAGG - Intronic
940055422 2:149507921-149507943 GTTGGGAACAGGGGTGAGGAGGG - Intergenic
940997444 2:160164999-160165021 CTGGGAACAAAGACTGAGGAGGG - Intronic
941021111 2:160408160-160408182 GGGGGAAAAAGAACAGAGGAGGG - Intronic
941312166 2:163947084-163947106 GCGGGAAATAGGATTGAGGATGG + Intergenic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
942879741 2:180844859-180844881 GTGGGATCCAGGACATAGGAAGG + Intergenic
943735450 2:191348898-191348920 GTGGGAAACAAGGCTGGAGAGGG - Intronic
944351846 2:198737359-198737381 GTGGCAACTAGGACTGAGGCTGG + Intergenic
944825979 2:203483669-203483691 GTGTGAACCAGGACTGAGTGGGG + Intronic
946144227 2:217716692-217716714 GCGGGAAATAGGGGTGAGGAAGG + Intronic
946335543 2:219032898-219032920 GGGGGAACCAAGGCTGAGGAGGG + Intronic
947018707 2:225650054-225650076 GGTGGAAACAGGACTGAGAGAGG + Intronic
947092606 2:226529347-226529369 GTGGAAAACAGAGCTGAAGATGG + Intergenic
947224134 2:227823930-227823952 TTGGGAAAAGGGACAGAGGATGG + Intergenic
947648971 2:231768267-231768289 GTTGGAGTCAGGAATGAGGAAGG - Intronic
948456280 2:238106042-238106064 GAGGAAAGCAGGAGTGAGGATGG - Intronic
948584361 2:239009680-239009702 GCGGGAAGCTGGTCTGAGGAAGG - Intergenic
948594966 2:239073949-239073971 ATGGGCAGCAGGACTGAGGGGGG + Intronic
948595004 2:239074073-239074095 GGGGGCCACAGGACTGAGGGGGG + Intronic
948725336 2:239930656-239930678 GTGGGAAACAGGGAGGTGGAAGG + Intronic
949017243 2:241720387-241720409 GTGGGGAACAGGCCTGAAGAGGG - Intronic
1168903189 20:1383184-1383206 CTGGGTAACAGGACTGAAGAAGG + Intronic
1168967895 20:1910439-1910461 CTGGGAAATGGGACTGAGGTAGG - Intronic
1170302847 20:14905460-14905482 GTGAGAAATAAGAGTGAGGAAGG + Intronic
1170597218 20:17815144-17815166 GAGGCAGACAGGACTGAGGATGG - Intergenic
1171182472 20:23100891-23100913 GGGGGAACCAGGAGTGATGAGGG + Intergenic
1172111298 20:32546776-32546798 GTGGGACACAGGAGAGAGCATGG + Intronic
1172191521 20:33064635-33064657 GCAGGAAACAGGGCCGAGGAGGG - Intronic
1172869522 20:38127034-38127056 GTGGGAAAGAGGCCTGAGGAGGG + Intronic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1173999520 20:47364251-47364273 CTGGGAAACAGGACGGGGCACGG - Intergenic
1175017914 20:55811603-55811625 GTGGGAGGTAGGAATGAGGAGGG - Intergenic
1175964907 20:62655559-62655581 GTGGGGAACAGGGCTGGTGAGGG + Intronic
1176049220 20:63107847-63107869 GTGGGGCAGAGAACTGAGGAGGG + Intergenic
1176195715 20:63835696-63835718 GTGGGAGCCAGGGCTCAGGAAGG - Intergenic
1176871252 21:14084556-14084578 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1177565866 21:22819188-22819210 GTGGGAACCAGGGCTGTGCATGG - Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178361029 21:31948616-31948638 GTGGGAAGGAGGAGAGAGGAAGG + Intronic
1178363923 21:31972754-31972776 GTGACAAACAGGAATGAGGAAGG + Intronic
1179189115 21:39108293-39108315 ATGAGAAACAGGATGGAGGAGGG + Intergenic
1179801172 21:43812118-43812140 CTGGGAAAGAGAACAGAGGAAGG - Intergenic
1181164414 22:20975793-20975815 GTGGGAAACAGGCCCGAGGAGGG + Intronic
1181316381 22:21973368-21973390 GTGGGAAGATGGACTGAGGCTGG - Intronic
1181391256 22:22583287-22583309 GTGGGTGTCAGGACTGGGGAGGG - Intergenic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1182194219 22:28497830-28497852 GTGAGGAATAGGGCTGAGGATGG + Intronic
1182269657 22:29145438-29145460 GCGGGGAACAGGGGTGAGGATGG - Intronic
1183383534 22:37502534-37502556 GAGGGGAACAGGAGTGAGGTGGG - Intronic
1183652828 22:39168748-39168770 GAGGGAAACAGGACTGAGGTGGG + Intergenic
1183928869 22:41224892-41224914 GAGGGAAGCAGGCCTCAGGAGGG - Intronic
949140228 3:623872-623894 ATAGGAAAGAGCACTGAGGAAGG - Intergenic
949438230 3:4051868-4051890 GTGGTAAACCGGTCTGAGTAAGG + Intronic
949453922 3:4218043-4218065 GAGAGAAACAAGAATGAGGAGGG + Intronic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
949838215 3:8291971-8291993 GTGGGGAGCAGGTTTGAGGAAGG + Intergenic
950265875 3:11572522-11572544 GAGGGGAATGGGACTGAGGAGGG - Intronic
950305053 3:11910797-11910819 GTGGGGAGCAGGCCTGAGCAGGG + Intergenic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950415051 3:12864361-12864383 GTGGGTAGCAGGCCTGAGCAGGG + Intronic
950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG + Intergenic
950647429 3:14385623-14385645 GTGGGAATCAGGAGGGAGGGAGG - Intergenic
952138063 3:30446025-30446047 GGGTGAAACAGTACTGAGGAAGG + Intergenic
952798347 3:37263389-37263411 GCGGGAAAGAGGGATGAGGAAGG + Intronic
952829882 3:37555812-37555834 GGGGGAAACAGAACAGAAGAAGG + Intronic
953042944 3:39271075-39271097 TTGGGAAAAAGGAATGGGGAAGG - Intronic
953546299 3:43865981-43866003 GTGGTAAACAGGACTTAGGCCGG + Intergenic
953657803 3:44867197-44867219 GTGGGAAGCAGGACAGAGGTAGG - Intronic
954089363 3:48272271-48272293 GTGGGAACCAGGGCTGCGCATGG - Intronic
954289881 3:49644032-49644054 GTGGGCCACAGGACTGAGGGAGG - Intronic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
957430833 3:80104226-80104248 ATAGGAAACAGGAGTGAGTAGGG - Intergenic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959131143 3:102357521-102357543 GTGAGAAACAGCACAGAGAAGGG + Intronic
959576698 3:107941968-107941990 GTAGGAAAGAGGAATGAGCATGG + Intergenic
959650702 3:108747962-108747984 CTGGGAGACAGGACGTAGGAAGG + Intronic
959907902 3:111730900-111730922 GTGGCAAACAGTACTGGGAAGGG - Intronic
960127421 3:114015359-114015381 CTGGGAAGCAGGGCTCAGGAAGG + Intronic
960571591 3:119190002-119190024 TCAGGAAACTGGACTGAGGAAGG + Intronic
962682179 3:137811827-137811849 TGGGGAAACAGAAATGAGGATGG - Intergenic
963722024 3:148872791-148872813 GTGACAAACAGGAGTGTGGAAGG + Intronic
963738398 3:149048535-149048557 ATGGCAAACAGGTTTGAGGATGG + Intronic
965242774 3:166225119-166225141 GTGGGAAATAGGACTGGGAAGGG + Intergenic
966781007 3:183584193-183584215 GTGGGACAAGGGACTCAGGAAGG - Intergenic
968134365 3:196210647-196210669 GAGTGAAACAAGACTGAAGAAGG + Exonic
968578345 4:1378186-1378208 GTGGGAGACAGGGCTGATGGGGG + Intronic
969113751 4:4859314-4859336 GCGGAAAAGAGGGCTGAGGAGGG + Intergenic
969211248 4:5689189-5689211 GTGGGAAACAGGACCTCGGAAGG - Exonic
969540317 4:7784519-7784541 AAGGGAGAGAGGACTGAGGAGGG + Intronic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
970457004 4:16234435-16234457 ATGGAAAACTGGGCTGAGGACGG + Intergenic
971408258 4:26342520-26342542 ATGGGAGAAAGGAATGAGGAGGG - Intronic
973041837 4:45477698-45477720 GCGGGAACCAGGGCTGAGCACGG - Intergenic
973045353 4:45530468-45530490 GTGGGAACCAGGGCTGCGCATGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973154201 4:46928670-46928692 GTTGGCAACAGAACTGAGGTGGG - Exonic
973195373 4:47433684-47433706 GTGGGGTCCAAGACTGAGGAGGG - Intergenic
973817254 4:54630523-54630545 TGAGGAAACAGGACTGAGGAAGG - Intergenic
973908984 4:55560249-55560271 GAGGGGAACAGGACTAAGTATGG + Intronic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
976151026 4:82091989-82092011 GTGGGAACCAGAACTGGGGTTGG + Intergenic
976367469 4:84246704-84246726 GGAGGACACAGGAGTGAGGAAGG - Intergenic
977113826 4:92995330-92995352 GTGGGAAGATGGAGTGAGGAGGG + Intronic
978334922 4:107656648-107656670 CTGGGAATCAGGGCTGAGGATGG - Intronic
979001074 4:115220597-115220619 GTGGAAAACAGGGATAAGGAAGG + Intergenic
979284730 4:118909545-118909567 GTGGGACACAGCACTGTGGAAGG + Intronic
980987613 4:139710955-139710977 GGGGGTAACAGGACAGAGAAGGG + Intronic
981051720 4:140315815-140315837 GTGGAAAAAAGGCCTGAGGCAGG - Intronic
981321194 4:143393961-143393983 AGGGGAAACAGGAATGAGAAAGG + Intronic
982877290 4:160664861-160664883 GTGGGAATCCATACTGAGGATGG - Intergenic
984819217 4:183865560-183865582 ATAGGATACAGGAATGAGGATGG + Intronic
987100985 5:14591001-14591023 GTAGAAAACAGAACTGGGGAAGG + Intronic
989108206 5:37883144-37883166 GAAGGAAGGAGGACTGAGGAAGG + Intergenic
989420393 5:41232275-41232297 GTAGGAAACAGAAGTGAGTAAGG - Intronic
990140279 5:52695262-52695284 ATGCGAAACAGCACTGAGAAAGG - Intergenic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
991150125 5:63358062-63358084 ATGGGAAACAGTGCTGAGGTAGG - Intergenic
991214912 5:64150093-64150115 GTGGGAACCGGGACTGTGCATGG + Intergenic
991587652 5:68216174-68216196 GGGGGAAACGGGAGTCAGGATGG - Intronic
992034137 5:72754720-72754742 GGGGGAAATAGGAATCAGGATGG - Intergenic
992986335 5:82234319-82234341 GTGGGAAACAGAGCAGATGAAGG - Intronic
993430438 5:87826057-87826079 GTGGCAGACAGGAAGGAGGATGG - Intergenic
994100303 5:95884084-95884106 GTGGGAGAAGGGACTGGGGAGGG + Intergenic
994301426 5:98152726-98152748 GTGGGAAACTGGAAGGTGGAAGG - Intergenic
994669719 5:102752080-102752102 GCGGGAACCAGGGCTGAGCAGGG + Intergenic
996018041 5:118562803-118562825 GGGGAAAACAGGAGTGGGGAAGG + Intergenic
996580760 5:125029626-125029648 ATGGGAAAAAGGGCAGAGGAGGG - Intergenic
996589593 5:125131955-125131977 GTGGGAACCAGGAGTGCTGATGG + Intergenic
996589626 5:125132151-125132173 GTGGGAACCAGGAGTGCTGATGG + Intergenic
997338629 5:133125184-133125206 TTGGGCAACAGGAATGATGAGGG + Intergenic
997371095 5:133360838-133360860 TTGGGAAACATGACAGAGAATGG - Intronic
997461260 5:134053941-134053963 GTGGGTTACAGGCCAGAGGAGGG + Intergenic
998817077 5:146025432-146025454 GTGGGAACCAGACCTCAGGAAGG - Intronic
999088165 5:148911722-148911744 TTAGGAAACTGGACTGAGGCTGG + Intergenic
1000303252 5:159973661-159973683 CTGGAAAAAAGCACTGAGGAAGG + Intergenic
1000373733 5:160560605-160560627 AGGGGAAACAGGACTGAGGGTGG - Intergenic
1000761614 5:165232405-165232427 GTGGGAAACAGAGCTCAGTAGGG - Intergenic
1001310063 5:170604102-170604124 GTGGGAACCAGGGAAGAGGAGGG + Intronic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1002069895 5:176672900-176672922 GAGGGAAACAGCAATGAGGCTGG + Intergenic
1003162783 6:3650638-3650660 CTGGGAAACAGGAGTGGGGCTGG - Intergenic
1003378668 6:5602805-5602827 GTGCCAAAAGGGACTGAGGAGGG - Intronic
1003528358 6:6917112-6917134 GTGGGAAGCTGGACTGAGCTGGG + Intergenic
1004139185 6:13000040-13000062 GTGGCACAAAGGACTGAGCAGGG + Intronic
1004160226 6:13206143-13206165 GTGGGCACCAGGAGGGAGGACGG + Intronic
1004194582 6:13491579-13491601 GAGGGAAAGAGGACTAAGAAAGG + Intergenic
1004211625 6:13651906-13651928 GTGGTAGAGAGGAGTGAGGAGGG - Intronic
1004960428 6:20782482-20782504 GGGGAAAAAAGAACTGAGGAAGG - Intronic
1006443557 6:34066689-34066711 GAGAGGAACAGGACTGAAGAAGG + Intronic
1006610909 6:35293830-35293852 GTCGGCATCAGGACTGGGGATGG - Exonic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1007324368 6:41048855-41048877 GTGGGAAACAGGACAGGGAGAGG + Intronic
1007509758 6:42365975-42365997 ATGGGAAACAAGATTGAAGAAGG - Intronic
1007948722 6:45850363-45850385 ATTGGAAACAGGAATGAGTAAGG - Intergenic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009302042 6:62036212-62036234 GTGGCAAACAGAAGAGAGGACGG + Intronic
1009426699 6:63522025-63522047 GTGGGAAAAAGCACTGGAGAGGG - Intronic
1010196849 6:73248172-73248194 GTGGGAGACAGACCTGAGGAGGG + Intronic
1011694119 6:89896628-89896650 GTGGAAAACAGTCCAGAGGAGGG + Intergenic
1012552176 6:100473646-100473668 ATGGGACACAGGACTGAGCCAGG - Intergenic
1013417677 6:109939260-109939282 CTGGGAAACACCATTGAGGAAGG + Intergenic
1013460753 6:110372820-110372842 GAGGGAAACAGGCCCTAGGATGG - Intergenic
1013998667 6:116340008-116340030 CTGAGAAAAAGGATTGAGGAAGG + Intronic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015241168 6:131025186-131025208 GGGGGAAACAGGCCTTAGAAAGG - Intronic
1015583358 6:134750524-134750546 GTGGGAAGGAGTGCTGAGGATGG + Intergenic
1016200613 6:141403081-141403103 GTGGGAAATAGGAAGGAGTAAGG - Intergenic
1016402112 6:143692187-143692209 GTGGCTCACAGGACTGGGGAGGG + Intronic
1016447946 6:144151886-144151908 GTGGGTAACAGCCCTTAGGAAGG + Intronic
1018656440 6:166041486-166041508 GTGGGAGCCAGGACTCAGGTCGG + Intergenic
1019372586 7:670720-670742 GAGGGACTCAGGACCGAGGACGG + Intronic
1019867359 7:3724761-3724783 GAAGGAAAAAGGAATGAGGAGGG + Intronic
1020053771 7:5102366-5102388 GTGGGAAACAGAATGAAGGAGGG - Intergenic
1020842026 7:13230086-13230108 GAGGGAAAAAGGAAAGAGGAAGG - Intergenic
1021290229 7:18834546-18834568 GTGGGAAAGAGGACTGGTGTAGG + Intronic
1022562727 7:31366396-31366418 GGGGGAGACTGGACTCAGGAAGG - Intergenic
1022747904 7:33191137-33191159 CTGAGAAGCAGGACTGGGGAGGG + Intronic
1023093077 7:36634042-36634064 ATGGGAAACAGGGCGGAGGAGGG + Intronic
1024116919 7:46203279-46203301 GTGGGACCCAGCACTCAGGACGG + Intergenic
1024558616 7:50624727-50624749 GTGAGAAAGAAAACTGAGGAAGG + Intronic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1026160209 7:67862046-67862068 GTGGGAAACAGGAATTGGGGAGG + Intergenic
1026869665 7:73842515-73842537 GTGGGCAACAGGACTCGGGGCGG + Exonic
1028267342 7:88742552-88742574 TTGGCAAGCAGGACTAAGGAGGG - Intergenic
1028585444 7:92447481-92447503 CTGGGAAGCAGGACTGGGAAAGG - Exonic
1029276403 7:99407765-99407787 GGGGGAAACAGGATAGAGAACGG + Intronic
1030293348 7:107893673-107893695 GAGGGAAACAACACTGAGAAAGG + Intronic
1031842674 7:126764828-126764850 GAGGGAGACAGGAATCAGGAAGG - Intronic
1032442483 7:131952607-131952629 GTGGGTGACAGGGCTCAGGAGGG + Intergenic
1032519914 7:132535998-132536020 GTGGGAAGCAGGAGAGAGGTGGG - Intronic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1033149197 7:138898462-138898484 GAGAGAAACAGGACTGAAAAGGG + Intronic
1033150854 7:138913926-138913948 GAGGGAGACAGGAGGGAGGAGGG + Intronic
1033150859 7:138913944-138913966 GAGGGAGACAGGAAGGAGGAGGG + Intronic
1033361221 7:140640440-140640462 GAGGGAAAGGGGACGGAGGAGGG - Intronic
1033362378 7:140646875-140646897 GTGGGAGAATGGGCTGAGGATGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034061454 7:148095145-148095167 GGGGAAAACAGGACTGAGCTTGG - Intronic
1034266060 7:149781186-149781208 GTGAGAGACAGGACTGAAGATGG - Intergenic
1034276683 7:149826841-149826863 GTGGGGAGCAGGGATGAGGAAGG + Intergenic
1034930207 7:155155466-155155488 GTGAGAAACATGTCTGGGGATGG - Intergenic
1035366818 7:158353890-158353912 GGGAGAAACAGCCCTGAGGATGG + Intronic
1035911896 8:3576431-3576453 GTGGTACACAGTGCTGAGGAGGG - Intronic
1038140015 8:24834158-24834180 CTGAGAACCAGGACTGTGGATGG - Intergenic
1038209564 8:25503464-25503486 CTCGGGAATAGGACTGAGGAGGG - Exonic
1038477624 8:27879295-27879317 CTGGGACACAGGACTGGGAAGGG + Intronic
1040280588 8:46039860-46039882 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1041105536 8:54440083-54440105 GTAGGAAACAGGGCTTAAGAAGG + Intergenic
1042284539 8:67093624-67093646 GTGGAAAAGAGTACTGAGGTAGG + Exonic
1042978486 8:74498817-74498839 GTGGGGAGCAGGACAGAGAAAGG - Intergenic
1043955383 8:86353278-86353300 GCTGGTCACAGGACTGAGGAGGG - Intronic
1044157848 8:88872188-88872210 GTGGGAAAGAGGACTTTGGATGG - Intergenic
1044646250 8:94446621-94446643 GTGGGAAATAGGAGACAGGAGGG - Intronic
1046707252 8:117468685-117468707 GAGAGAAACAGAAGTGAGGAGGG - Intergenic
1047109283 8:121771044-121771066 GTGGGAAACACGACAAAGGGAGG - Intergenic
1047951425 8:129939226-129939248 GTGGGAGCCAGGATTGGGGAGGG + Intronic
1048821384 8:138383863-138383885 ATGGGAACCAAGACAGAGGATGG - Intronic
1049248593 8:141576175-141576197 CTGGGTACCAGGACTGATGAGGG + Intergenic
1049857906 8:144875183-144875205 GTGGGAACCAGGGCTGCGCACGG + Intergenic
1050110839 9:2214129-2214151 GTGAGAAACAGGACTGAGATAGG + Intergenic
1050434984 9:5599652-5599674 GTGGGACAGAGAAGTGAGGAAGG + Intergenic
1052157004 9:25204363-25204385 GTAGGAATGAGGACTGAGTAGGG - Intergenic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1053017023 9:34667672-34667694 GGGGCAGACAGGACTGGGGAGGG + Intergenic
1053350801 9:37412153-37412175 GTGGGAAGCAGGAGAGGGGAGGG - Intergenic
1053840805 9:42187193-42187215 CTGGGAAAGAAGACTGAAGATGG - Exonic
1055985540 9:82054680-82054702 GTGGGAACCAGGGCTGTGCATGG - Intergenic
1055986517 9:82060142-82060164 CTGGGAAAGAGGATTGAAGATGG + Intergenic
1056584827 9:87920990-87921012 CTGGGAAAGAGGATTGAAGATGG - Intergenic
1056612054 9:88131950-88131972 CTGGGAAAGAGGATTGAAGATGG + Intergenic
1056956776 9:91089035-91089057 GGGGGATTCAGGACTGAGGGAGG - Intergenic
1057020512 9:91693722-91693744 GAGGGAACCAGGAGTGAGGCAGG + Intronic
1057160648 9:92886043-92886065 CTGGGAAAGAGGATTGAAGATGG - Intergenic
1057333622 9:94139668-94139690 TTTAGAGACAGGACTGAGGAGGG - Intergenic
1057885051 9:98823591-98823613 GTGGGAAACTGGAAGGAGCAGGG + Intronic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1059437344 9:114284676-114284698 GTGAGAATGAGGACTCAGGAAGG - Intronic
1059599357 9:115759624-115759646 TTGAGAAACAGGACGGATGATGG + Intergenic
1060077760 9:120608713-120608735 GAGGAAGACAGGACTCAGGAAGG - Intronic
1060472448 9:123959513-123959535 GTGGGAAAGAGGAATTTGGATGG - Intergenic
1061002173 9:127908589-127908611 GTGGGGAACAGGGCTGGGGTGGG + Intronic
1061043584 9:128152881-128152903 GTGGGAGAAAGGCCTGGGGAGGG - Intronic
1061201010 9:129138586-129138608 GTCGGGAAAGGGACTGAGGAGGG - Intronic
1061274965 9:129564724-129564746 GGGAAAAACAGGACTGAGGATGG + Intergenic
1061618391 9:131794814-131794836 ATGGGACAAAGGACTCAGGATGG + Intergenic
1062099271 9:134719748-134719770 GTTGGTAAGAGGACGGAGGATGG + Intronic
1062327121 9:136017730-136017752 CTGGGACACAGGAATGAGGGAGG - Intronic
1062712273 9:137982620-137982642 GTGGAAAACAGGACAGATGCTGG + Intronic
1185758565 X:2672091-2672113 CTGGGAGACAGGACTTTGGAAGG - Intergenic
1185938376 X:4284841-4284863 GTGGGAATCTGGACAGAGTATGG + Intergenic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1188465827 X:30480017-30480039 GAGGGAAACAGGACAAAGAAGGG - Intergenic
1188585392 X:31768314-31768336 GTGGGAGACAGGAGGGAGAAAGG - Intronic
1189241208 X:39526127-39526149 GTGGGATATAGGACAGGGGAGGG - Intergenic
1189387060 X:40545709-40545731 GTGGGATCCATGACTGAGGAAGG - Intergenic
1190204796 X:48394281-48394303 AGGGGAAACAGGTCTGCGGAAGG + Intergenic
1190205740 X:48401122-48401144 AGGGGAAACAGGTCTGCGGAAGG - Intergenic
1190558996 X:51669072-51669094 AAAGGAAACAGGACTGGGGAGGG + Intergenic
1190565295 X:51724250-51724272 AAAGGAAACAGGACTGGGGAGGG - Intergenic
1191884311 X:65873652-65873674 GTGGGAGATAGGGCTGAGGGAGG - Intergenic
1192491453 X:71579665-71579687 GTGGGAGACAGGAGTGGGGTAGG + Intronic
1193052893 X:77120038-77120060 GGGGGAAAGAAGACTGAGGCTGG - Intergenic
1195283266 X:103357351-103357373 GGGGGAAAAAGGTCTGGGGAGGG + Intronic
1197032646 X:121836208-121836230 GTGGGAAACAAGACTAGGGAGGG + Intergenic
1197100151 X:122643789-122643811 GTGAGGAACAGGATTTAGGAGGG - Intergenic
1197923704 X:131624290-131624312 GTGGGAAGCAGCAAAGAGGACGG - Intergenic
1198080386 X:133234292-133234314 GGGTGAGAGAGGACTGAGGAAGG + Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1201945435 Y:19505057-19505079 GTGGGGAACAGGGGTGAAGAAGG + Intergenic
1202142570 Y:21743670-21743692 GTGGCACCCAGTACTGAGGAGGG - Intergenic
1202144288 Y:21761948-21761970 GTGGCACCCAGTACTGAGGAGGG + Intergenic
1202232339 Y:22670134-22670156 CGGGGAAACATGAGTGAGGATGG + Intergenic
1202310817 Y:23526024-23526046 CGGGGAAACATGAGTGAGGATGG - Intergenic
1202395425 Y:24419354-24419376 GTGGGAGCCAGGACTGTGCATGG + Intergenic
1202559985 Y:26144570-26144592 CGGGGAAACATGAGTGAGGATGG + Intergenic