ID: 956890882

View in Genome Browser
Species Human (GRCh38)
Location 3:73613191-73613213
Sequence ATTTTTATTCTGAAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 1, 2: 2, 3: 41, 4: 509}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956890877_956890882 -9 Left 956890877 3:73613177-73613199 CCACCAGGTAGACAATTTTTATT 0: 1
1: 0
2: 1
3: 21
4: 307
Right 956890882 3:73613191-73613213 ATTTTTATTCTGAAGGTGGTGGG 0: 1
1: 1
2: 2
3: 41
4: 509
956890876_956890882 3 Left 956890876 3:73613165-73613187 CCAGTGGAGTGACCACCAGGTAG 0: 1
1: 0
2: 0
3: 12
4: 103
Right 956890882 3:73613191-73613213 ATTTTTATTCTGAAGGTGGTGGG 0: 1
1: 1
2: 2
3: 41
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956890882 Original CRISPR ATTTTTATTCTGAAGGTGGT GGG Intronic
900011622 1:116085-116107 ATTGTTATTATGAAATTGGTTGG + Intergenic
900027727 1:292651-292673 ATTGTTATTATGAAATTGGTTGG + Intergenic
900041682 1:472092-472114 ATTGTTATTATGAAATTGGTTGG + Intergenic
900063117 1:707070-707092 ATTGTTATTATGAAATTGGTTGG + Intergenic
902166801 1:14578979-14579001 ATTTTTATTAGGCAGGTGCTGGG - Intergenic
902968886 1:20032356-20032378 TTTTTTTTTTTGATGGTGGTAGG + Intronic
905385761 1:37602870-37602892 ATTCTTATTTTGAATTTGGTCGG - Intergenic
906552262 1:46674807-46674829 TTTTTTTTTTTTAAGGTGGTGGG + Intergenic
907179490 1:52557080-52557102 GTTTTTATTCTGAAGTTAATGGG + Intergenic
907661047 1:56392711-56392733 CTTTTTATTCTGAAGGAAGTGGG - Intergenic
907682822 1:56579713-56579735 TTTTTTTTTTTGAAGGGGGTGGG - Intronic
908831615 1:68184615-68184637 ATTTTTACTCTAAAGGAGTTAGG - Intronic
909011521 1:70340501-70340523 CTTTTTATTCTGCAGTTGTTGGG + Intronic
909266470 1:73565024-73565046 CTTTTTATTGTGTGGGTGGTGGG - Intergenic
909825651 1:80123575-80123597 ATTTTTATTCTGAAATTTGCAGG - Intergenic
909858226 1:80569026-80569048 ATTTTTACTCTTGAGGTGTTTGG + Intergenic
909868789 1:80711331-80711353 CTTTTTTTTCTGAAAGTGTTAGG - Intergenic
909984311 1:82141859-82141881 ATTCTTATTCAGAGGGTAGTGGG + Intergenic
910036710 1:82797733-82797755 ATCTTTATCCTGAAAGTGATGGG - Intergenic
910127768 1:83862120-83862142 ACTTTCATTCTAAAGGTGCTGGG - Intergenic
910784504 1:90980458-90980480 CATTTTATTCTGAAAGTGATGGG + Intronic
911223804 1:95281257-95281279 GTTTTTCTTCTGGACGTGGTTGG + Intergenic
911285191 1:95982980-95983002 TTTTTTATTCTGAATGAGATGGG + Intergenic
911684889 1:100764292-100764314 ATTTTTATTTTAAAAGTGTTAGG - Intergenic
911839837 1:102667060-102667082 ATTGCTATTGTGATGGTGGTTGG + Intergenic
912265395 1:108152150-108152172 GATTTTATTCTGAATATGGTAGG - Intronic
912414412 1:109498339-109498361 ATTTATATTCTGCAGGAGGAAGG + Intronic
912611977 1:111057227-111057249 ATGTATATTCTGAAGTTGTTGGG + Intergenic
912679022 1:111716758-111716780 ATTTTTGTGCTGAATGTTGTAGG + Intronic
912778944 1:112526104-112526126 ATTTCTGTTTTGAAGGTGCTGGG - Exonic
913004941 1:114620318-114620340 ATATTTTTTCTGAAGGTTTTTGG - Intronic
913171520 1:116236894-116236916 ATTTTTATTCCCAAGATTGTTGG + Intergenic
913193157 1:116430642-116430664 TTTTTTTTTTTAAAGGTGGTAGG + Intergenic
913315117 1:117543151-117543173 TTTTTTTTTCTAAGGGTGGTAGG + Intergenic
913493741 1:119407410-119407432 ATGTATATTCTGAAGTTGTTCGG - Intergenic
913529664 1:119724722-119724744 ACTTTTTTTCTGGAGGTGGAAGG + Intronic
917193091 1:172439519-172439541 AAATTCATTGTGAAGGTGGTGGG - Intronic
917415351 1:174803766-174803788 ATTTTTTTTTTGAAAGAGGTAGG - Intronic
917686347 1:177419895-177419917 ATTTTCATCATGAAGGTAGTTGG - Intergenic
918188906 1:182152706-182152728 ATTTTTATTTGAAGGGTGGTGGG - Intergenic
918875956 1:190043867-190043889 ATTTTTAGTCTCAAGGTGCTTGG + Intergenic
919110483 1:193213071-193213093 ATTTTAAATCTGAAAGTGGTTGG - Intronic
919444161 1:197680261-197680283 ATATTTAGTCTGAAGGGGGTAGG - Intronic
919581321 1:199377810-199377832 ATTTTTAATCTCAAGATGATAGG + Intergenic
921399863 1:214709791-214709813 ATTTTTATTTTTAAAGAGGTGGG + Intergenic
923837601 1:237631099-237631121 ATTTTTATCCAGAAGAAGGTTGG + Intronic
924426356 1:243953541-243953563 ATTTTTATTCTGTAGGATGAAGG + Intergenic
1063025838 10:2178308-2178330 ATTTTTATTCTGCGTGTGATGGG - Intergenic
1063077514 10:2731761-2731783 ATTTTTATTCAGAATGTTCTAGG + Intergenic
1063915851 10:10881359-10881381 ATTTTTATTCTGAAGGAAATAGG - Intergenic
1064613343 10:17126669-17126691 ATTCTTATTTTGAAGGTGAATGG - Intronic
1064751136 10:18530199-18530221 GTCATTATTCTTAAGGTGGTAGG + Intronic
1065405112 10:25355768-25355790 CTGTTTATTCTGAATGGGGTGGG + Intronic
1065531010 10:26670106-26670128 ATTTTTATTTTAAAGGTGTTTGG - Intergenic
1068576899 10:58694348-58694370 ATTTCTCTTCTGAAGTTTGTTGG - Intronic
1069434304 10:68367424-68367446 ATTTTTTTTCTGAATGTTTTGGG + Intronic
1070535013 10:77370540-77370562 TTTTTTATTCTAAAGGTCTTTGG - Intronic
1072304215 10:94091695-94091717 ATTTTTATGCTGAAGCTCCTTGG - Intronic
1072444706 10:95488989-95489011 ATTTTTACTCTGAGAGTGATTGG - Intronic
1072493888 10:95935522-95935544 ACTTTTATTGTGAATGAGGTAGG - Intronic
1073072700 10:100805088-100805110 ATATCTATTCTGGAGGGGGTGGG - Intronic
1073758049 10:106602219-106602241 ATATTTATTCTGAAGGTGGTAGG + Intronic
1075229546 10:120663338-120663360 ATTGTTATTCTGAAGCTATTAGG + Intergenic
1075372965 10:121953471-121953493 ATTTCTGTGCTGAGGGTGGTAGG - Intergenic
1075494007 10:122902750-122902772 ATGTATATTCTGAAGTTGTTGGG - Intergenic
1076967955 11:108321-108343 ATTGTTATTATGAAATTGGTTGG + Intergenic
1077847894 11:6045332-6045354 TTTTTGACTCTGAAGGTGGAGGG + Intergenic
1077996397 11:7456107-7456129 ATTTTTATTTTGTAGTTAGTTGG + Intronic
1078389130 11:10920527-10920549 ATTTCTATTCTGAAAATGGAGGG - Intergenic
1078879737 11:15436385-15436407 GTTTTTATTTTGAAGGTGGGAGG + Intergenic
1079029973 11:16979377-16979399 AGCTTTGCTCTGAAGGTGGTGGG - Intronic
1079746024 11:24131417-24131439 GTTTTTATTATGAAGGTGAGAGG + Intergenic
1079782564 11:24626299-24626321 ATTTTTGTTTTGCAGGTGATAGG - Intronic
1081019416 11:37925934-37925956 ATATTTATTCTTAGGGTGCTAGG + Intergenic
1081160913 11:39747208-39747230 TTCTTTATTTTGAAAGTGGTGGG - Intergenic
1082265657 11:50115159-50115181 ATTTTGATTCAGAAGATTGTAGG - Intergenic
1082290430 11:50363411-50363433 ATTTTGATTCAGAAGATTGTAGG + Intergenic
1082864151 11:57883177-57883199 ATTTTTATTCAAAACCTGGTTGG - Intergenic
1083874603 11:65514883-65514905 ATTTTTATGCTGGAGGAGGGCGG + Intergenic
1084350766 11:68597400-68597422 AGTTGTATTCTGAAGGTTGTAGG + Intronic
1085228372 11:74943077-74943099 CTTTTTATTCTCTAGGTGTTAGG - Intronic
1086140446 11:83492971-83492993 GGTTTTATTCTGAATGAGGTGGG - Intronic
1086385281 11:86301120-86301142 CTTTTTATTCTGAAGGTTCTAGG + Intergenic
1087554886 11:99705499-99705521 ATATTTATTCTGTACTTGGTTGG + Intronic
1087563292 11:99818779-99818801 ATTTTAATTCCTAAGGTGTTTGG - Intronic
1088206040 11:107393930-107393952 ATTTTTATTATTCAGGTGATGGG + Intronic
1089280132 11:117368440-117368462 AATTTTATCCTGAAGGCAGTAGG + Intronic
1089438358 11:118492151-118492173 CTTTATACTCTGAAGGTGATAGG + Intronic
1089875787 11:121720516-121720538 AATTTTATTCTAAATGTAGTAGG - Intergenic
1090674429 11:128976627-128976649 TTTTTTATTCTTCAGGTGGCAGG - Exonic
1090779828 11:129997537-129997559 ACTTTGATTCTAAAGGTGGAAGG - Intronic
1091927277 12:4364177-4364199 GTTTTTAATCTGTAGTTGGTTGG + Intergenic
1093001809 12:14005560-14005582 ATTCATATTCTGCAGGTGTTGGG + Intergenic
1093092773 12:14939510-14939532 AATTTTATTCTGTAGGTGATGGG + Intergenic
1093289839 12:17306321-17306343 ATATTTATTCTGTAGTTGTTAGG + Intergenic
1093482476 12:19619136-19619158 ATTTTTATTTTAAATGAGGTGGG + Intronic
1093884392 12:24442826-24442848 GCTTTTATTCTGAAGGTGGCAGG + Intergenic
1094202417 12:27807510-27807532 ATTTTTTTTTTTAAGGAGGTAGG + Intergenic
1094569777 12:31631652-31631674 ATTTTTATTTAGAAAGTGGCAGG - Intergenic
1096954827 12:55515841-55515863 ATCTTTAGTCAGAAGGTGATGGG - Intergenic
1097420143 12:59367128-59367150 ATTTTTAATCTGAAGTTCTTTGG - Intergenic
1097497295 12:60356387-60356409 GTCTTTCTTCTGAAGGTGCTTGG + Intergenic
1097533733 12:60838927-60838949 ATCTTTATTCTGAAAGGGTTTGG + Intergenic
1097606004 12:61755182-61755204 ATTTCTTTTCTAAATGTGGTAGG + Intronic
1097665242 12:62470800-62470822 AATTTTATACTGAAGATGATTGG + Intronic
1097692398 12:62745779-62745801 ACTTTTATTTTGAATGTGATTGG - Intronic
1097801315 12:63917448-63917470 ATTTTTATTGTGAGTGTGTTGGG + Intronic
1098003200 12:65967738-65967760 ATTTTTCTTCTGAAGTAGGAGGG + Intergenic
1098369865 12:69746493-69746515 ATGATTATTCTGAGGGTTGTGGG - Intronic
1099205234 12:79719250-79719272 GATTTTATTCTGAAGGTGACTGG + Intergenic
1099902418 12:88728074-88728096 TTTTTTATTCTGAAGGCAATAGG + Intergenic
1101555516 12:105805214-105805236 ATTTCTATGCAGAAGGTGATAGG - Intergenic
1101660728 12:106763350-106763372 ATTTTTATTCTGAGGCTGAAAGG + Intronic
1101784274 12:107869134-107869156 ATGTGTATTCTGAAGTTGTTGGG - Intergenic
1102386579 12:112515283-112515305 GCTTTTATTCTGAATGTGATGGG - Intergenic
1102618556 12:114175656-114175678 ATTTTTATTGTAAAGCTGTTTGG + Intergenic
1102818873 12:115891134-115891156 ATTTTTTTTCTAAATGTGATGGG - Intergenic
1103789958 12:123462827-123462849 GATTTTATTCTGTAGGTGTTTGG + Intronic
1104269170 12:127266906-127266928 TTTTTTATTCTGAATGAGGTGGG + Intergenic
1104353957 12:128068742-128068764 ATTTCTAATGTGATGGTGGTAGG - Intergenic
1104602832 12:130164464-130164486 ATCTTTATGCTGCTGGTGGTGGG + Exonic
1106107480 13:26745481-26745503 ATTTTTATTTTAAAGGCGGAAGG + Intergenic
1106492354 13:30238140-30238162 ATTCTTTTTCTGTAGGTGTTTGG - Intronic
1107815688 13:44242582-44242604 ATTCTTATTCATGAGGTGGTGGG - Intergenic
1108132106 13:47312750-47312772 ATGTATATTCTGCAGGTGTTGGG - Intergenic
1108867353 13:54939374-54939396 ATTTTTATTAAGGAGGTGGCAGG + Intergenic
1108869539 13:54966198-54966220 ATTTTTAGTTTGAATGTGATGGG + Intergenic
1108898429 13:55365467-55365489 TTTTTTTTTCTGGAGGAGGTGGG - Intergenic
1109285698 13:60405730-60405752 ATTTTTATTTTGAAGGCAATAGG + Intronic
1109798321 13:67344196-67344218 AATCTTATTGTGAAGGAGGTAGG - Intergenic
1109924694 13:69120855-69120877 ATGTATATTCTGAAGTTGTTGGG - Intergenic
1109950475 13:69496475-69496497 ATTTTTATTCTAAAGAAAGTAGG + Intergenic
1110340711 13:74386709-74386731 ATGTATATTCTGAAGTTGTTGGG + Intergenic
1110375793 13:74792561-74792583 ATTAATATTCTGCAGTTGGTGGG + Intergenic
1110504936 13:76274359-76274381 ATGTATATTCTGAAGTTGTTGGG - Intergenic
1110803184 13:79724145-79724167 ATTTTTATTATGCAGATGGCTGG + Intergenic
1111580635 13:90218892-90218914 ATGTATATTCTGCAGTTGGTGGG - Intergenic
1111742235 13:92218629-92218651 ATTTTTCTAGTGAAGGCGGTTGG - Intronic
1112262410 13:97888986-97889008 ATTTTTATTGTGACAGTGGTGGG - Intergenic
1112296793 13:98194921-98194943 GTTTTTATTCAGAATGTGCTTGG + Intronic
1113027889 13:105961237-105961259 ATTTTTATTTTGACGATGATAGG + Intergenic
1113100334 13:106710907-106710929 ATTTTTGTTTTGAAGGCAGTGGG + Intergenic
1113427270 13:110218990-110219012 ATGTCTCTTCTGATGGTGGTTGG - Intronic
1114725160 14:24928780-24928802 ATTTATATTCTGAGGGTGCATGG - Intronic
1114761273 14:25317667-25317689 AATTTTTTTCTTAAGATGGTTGG + Intergenic
1114833214 14:26170706-26170728 ATGTATATTCTAAAGTTGGTAGG + Intergenic
1115661978 14:35505062-35505084 ATTTTTTTTCTGAAGAAGGTTGG + Intergenic
1116134027 14:40897666-40897688 ATTTTTGTTGTGGTGGTGGTGGG + Intergenic
1117193221 14:53314182-53314204 ATGTTTATTCTGCAGTTGTTGGG + Intergenic
1117604706 14:57416080-57416102 ATTTTTATCCTGATGATAGTGGG + Intergenic
1117747251 14:58882382-58882404 ATTTTAATTTAGAAGGTAGTAGG + Intergenic
1118342979 14:64911507-64911529 GATTTTATTCTGCATGTGGTAGG - Intergenic
1119244478 14:73092188-73092210 ATTTTTTTTTTAAGGGTGGTGGG + Intronic
1119257822 14:73214550-73214572 TTATTTATTGTGAAGGTAGTTGG - Intronic
1119298237 14:73550554-73550576 ATGATTATTCATAAGGTGGTGGG - Intronic
1119302527 14:73582738-73582760 ATGATTATTCATAAGGTGGTGGG - Intergenic
1119926281 14:78497401-78497423 TTTTTTATTATGTAGGTGGTGGG - Intronic
1120284395 14:82479982-82480004 ATTTTTATTCTGTAAGTGTAAGG - Intergenic
1121296902 14:92834695-92834717 ACTTTTACTCTGAATGAGGTAGG + Intronic
1121378455 14:93436439-93436461 ATTATGATTCTTAAAGTGGTAGG + Intronic
1122193125 14:100063738-100063760 ATGTGTATTCTGAAACTGGTCGG - Intronic
1122446585 14:101774004-101774026 GTTTTTATTCTGAGGGTCATGGG + Intronic
1125145622 15:36464510-36464532 ATGTGTATTCTGAAGTTGTTGGG + Intergenic
1125801424 15:42451648-42451670 ATAGTAATTCTGGAGGTGGTTGG - Exonic
1127102465 15:55581446-55581468 ATTTTTACTCTAAAGGTAATAGG + Intronic
1130235687 15:82131465-82131487 ATTTTTTTTCTGGAGGTGGTGGG + Intronic
1130444548 15:83988256-83988278 ATTTTCATGCTGGAGGTGATTGG - Intronic
1130604428 15:85302469-85302491 ATTTGTCTTCTGAAGTTGGAGGG - Intergenic
1130743849 15:86629510-86629532 ATTCTTATTCTGAATGTGTGGGG - Intronic
1131501635 15:92972944-92972966 ATTCTTTTTTTGAAGGTGGGTGG + Intronic
1132360121 15:101205649-101205671 ATTTTAATTTTGAAGATTGTTGG + Intronic
1133310867 16:4846347-4846369 ATTTTACTTCTGAGGGTGTTGGG - Intronic
1134080098 16:11319158-11319180 GGGTTTATTCTGAAGGTGGGAGG + Intronic
1134212852 16:12292347-12292369 TTTCTTTTTCTGAAAGTGGTAGG + Intronic
1137863922 16:51874152-51874174 ATTTTATTTCTGAAGGTTTTGGG - Intergenic
1138148220 16:54631287-54631309 ATTTTATTTCTTAAGGTGGGTGG + Intergenic
1138200658 16:55085858-55085880 GCTTTTATTCTGAGTGTGGTGGG + Intergenic
1138995271 16:62444177-62444199 TTTTTTATTCTGAATGTGTGGGG - Intergenic
1144089105 17:11837705-11837727 GGTTTTATTCTGAATGTGATGGG - Intronic
1144175535 17:12702005-12702027 ATGTTTATTCTGCAGTTGTTAGG + Intronic
1144449364 17:15363148-15363170 ATTTTTAATTGGATGGTGGTAGG + Intergenic
1145837440 17:27965273-27965295 ATTTTTATCCTAATGGAGGTGGG - Intergenic
1146530597 17:33604652-33604674 ATTTTCATCCTGGAGGTGGCTGG + Intronic
1146533033 17:33626910-33626932 GTTTTTATTCTGAAGGTGAGGGG - Intronic
1146546387 17:33742340-33742362 ATTTTTTTTCTAAAGCTGGCTGG + Intronic
1147650721 17:42060371-42060393 ACCTTTGTTCTGAAGGTGATGGG - Intronic
1148348326 17:46919605-46919627 ATTTTTATTCTGCGGGTAGTTGG - Intergenic
1148524858 17:48321878-48321900 ACCTTTATTTTGAAGGTGATAGG - Intronic
1149246678 17:54716775-54716797 GTTTTTATTCCGAATGAGGTTGG - Intergenic
1150170046 17:62984914-62984936 ATGTGTATTCTGCAGGTGTTGGG + Intergenic
1150513895 17:65787117-65787139 ATTTTGATTTTGTATGTGGTAGG + Intronic
1150866762 17:68859040-68859062 ATTTTTCTTCTGAGGGAGCTTGG + Intergenic
1151036036 17:70801076-70801098 ATTTTTACTGGAAAGGTGGTTGG - Intergenic
1151063671 17:71126018-71126040 ATTTTTTTTTTGCAGGGGGTGGG + Intergenic
1151171130 17:72247257-72247279 ATTTTCACTCTGAAGCTGTTTGG + Intergenic
1151638988 17:75375448-75375470 ATTTTTATTCTGCTGTTGTTGGG - Intronic
1152212262 17:79009028-79009050 ATTTGAAGTCAGAAGGTGGTGGG + Intronic
1153587232 18:6634962-6634984 AATTTTATTCTGAATGAGATGGG - Intergenic
1155205200 18:23552446-23552468 ATTTTTATTCTGGAGGCACTGGG + Intronic
1156516680 18:37686130-37686152 GTTGTTATTTTGAAGGTGGTGGG + Intergenic
1156667708 18:39427945-39427967 ATGTATATTCTGAAGTTGTTGGG - Intergenic
1156676314 18:39530689-39530711 GATTTTATTCTGTAGGTGATGGG - Intergenic
1156772495 18:40746436-40746458 ATTTTTATTCTGTATCTGCTTGG - Intergenic
1156971040 18:43156390-43156412 ATTTTTATTCTTAATTTGTTTGG + Intergenic
1158793527 18:60812662-60812684 ATTTTTATTCTGAATGTGAAGGG - Intergenic
1159226118 18:65538276-65538298 ATTTTTATTAGTCAGGTGGTAGG + Intergenic
1159804092 18:72934301-72934323 ATTTGTATTCTGAGGGTGGATGG + Intergenic
1159892965 18:73969885-73969907 ATTTTTATTGTGAAACTGTTGGG - Intergenic
1160211207 18:76881585-76881607 TTTTTTCCTCTGAAGGTGATAGG + Intronic
1160644762 19:177944-177966 ATTGTTATTATGAAATTGGTTGG + Intergenic
1162950131 19:14066504-14066526 ATTTTTATTCTAAATTTGGTGGG + Intergenic
1163886342 19:19968373-19968395 ATGTATATTCTGAAGTTGTTGGG + Intergenic
1164452280 19:28377107-28377129 ACTTTTATTTTAAATGTGGTGGG - Intergenic
1164470759 19:28529488-28529510 ATCTTTTTTCTGAGGTTGGTTGG - Intergenic
1164651819 19:29896144-29896166 TTTTTTTTTCGGTAGGTGGTGGG - Intergenic
1165403529 19:35616818-35616840 ATTGTTATTCTGAATGCGCTGGG + Intronic
1165929567 19:39347913-39347935 ATTTATATTCTGATGGGGGGAGG + Intronic
1166174336 19:41055335-41055357 ATTTTTATCCTGAAAGTGAGGGG + Intergenic
1167144640 19:47674348-47674370 ATTTTTATTCTGAATGTGACAGG + Intronic
1167198932 19:48050537-48050559 AATATTATTCTGAATATGGTGGG - Intronic
1168700946 19:58439357-58439379 ACCTCTATTCTGATGGTGGTGGG - Intronic
925567035 2:5267420-5267442 ATTTATTTTCTGAAAGTTGTTGG + Intergenic
926532991 2:14074707-14074729 ATTATTATGCTGCAGGTGGAAGG - Intergenic
931503518 2:62898124-62898146 AATTTTATTCTGCAGGTTATGGG + Intronic
931949276 2:67343628-67343650 CTTTTTTTTTTGATGGTGGTGGG - Intergenic
932027720 2:68152816-68152838 ATTTTTGTTCTGCATGTGGGTGG + Intronic
932033763 2:68219092-68219114 GTTTTTATTCTGAAGGCAGGTGG - Intronic
932114134 2:69030412-69030434 GTTTTTATTCAGAAGTTGGTGGG - Intronic
932282393 2:70505262-70505284 ATCTTTATTCTGAAAAAGGTTGG + Intronic
932325595 2:70858827-70858849 ATGTGTATTCTGCAGCTGGTAGG + Intergenic
932944100 2:76207236-76207258 ATTTTTACTCTGAGGGATGTGGG - Intergenic
933769025 2:85731296-85731318 AATTTTATTCTGAAGTTTTTTGG - Intergenic
935000799 2:99012855-99012877 ATTTATATTCTGCAGTTGTTGGG - Intronic
935253461 2:101286666-101286688 TTTTTTATTCTGAAAGTGATAGG - Intronic
935439790 2:103078948-103078970 ATTTATATTCTGAAGTTATTGGG + Intergenic
936548362 2:113412573-113412595 ATTTCTATTCTGAAAGAGGATGG - Intergenic
936584224 2:113739381-113739403 ATTTTTGATCTGCAGTTGGTTGG + Intronic
936816510 2:116467428-116467450 ATTGTTGTCCTGAAGGTTGTTGG - Intergenic
937549007 2:123063442-123063464 ATTTTTATTTTGCAGGGTGTTGG - Intergenic
937593427 2:123643551-123643573 ATTTTTATTCTGAAGAAAGATGG - Intergenic
938629705 2:133153584-133153606 AACTTTATTCTGAAGGTAGAAGG - Intronic
939863836 2:147450553-147450575 ATTGGTATTCTGAAGGTGTTTGG - Intergenic
940117836 2:150228852-150228874 ATTTTTATTTTAAAAGTGGGTGG + Intergenic
940451201 2:153839974-153839996 ATTTTTTTTCAAAAGGTGATAGG + Intergenic
940616995 2:156061196-156061218 ATTTTTATTTTGAAAGTCATTGG + Intergenic
940903469 2:159147523-159147545 ATTTTGATTCTCAAGGTAGCTGG - Intronic
941292445 2:163694125-163694147 CTTTTTATTCTGATAGTGGAAGG + Intronic
941420016 2:165272541-165272563 ATGTATATTCTGAAGTTGTTGGG - Intronic
941475733 2:165950358-165950380 ATTTTTATTCAGAAGTTAGTAGG - Intronic
942809619 2:179982397-179982419 GTTTTTATACTGGAGGTGATGGG + Intronic
943471750 2:188303240-188303262 CTTTTTGCCCTGAAGGTGGTAGG + Intronic
943778062 2:191789267-191789289 ATTTTTAATCTGCAGACGGTAGG + Intergenic
944982491 2:205137563-205137585 ATTTTAACTCTTAAAGTGGTGGG - Intronic
945442993 2:209902632-209902654 ATTTTTATTTTGCTGGTGGAGGG - Intronic
945465238 2:210161884-210161906 ATTTTTATTTTAAAGTTTGTGGG + Intronic
945534211 2:210991825-210991847 ATTTTTAGTCTGGATGTGATAGG + Intergenic
945790727 2:214302242-214302264 ATGTATATTCTGAAGTTGTTGGG + Intronic
946300594 2:218821530-218821552 AGCTTGATTCTGAAGGTGGGTGG + Intergenic
946383567 2:219366808-219366830 ATTTTTATTATGAAAGGGTTTGG + Intergenic
946802094 2:223429097-223429119 ATGTTTATTCTGCAGTTGTTGGG + Intergenic
948552743 2:238785478-238785500 ATTTTTTTTTTTAAAGTGGTGGG + Intergenic
1169373276 20:5044888-5044910 ATTTTTCTTCTGAACTTGGGTGG - Intergenic
1169599641 20:7242792-7242814 GTTTTTATTGTTAATGTGGTTGG + Intergenic
1170116173 20:12862527-12862549 AGTTTTATTCTAAATGTGGTGGG - Intergenic
1170490440 20:16867491-16867513 ATATGTATTCTGAAGATGTTTGG - Intergenic
1171032602 20:21690998-21691020 AACTTTATTCTGCAGGTGGTGGG + Intergenic
1173740515 20:45397080-45397102 ATGTTTATTCTGCTGTTGGTGGG + Intronic
1174391103 20:50218871-50218893 ATCTTTATTCTGAAGGCAGTAGG - Intergenic
1174514847 20:51083766-51083788 GTTTTTATTGTGAAGGATGTGGG + Intergenic
1174838551 20:53880422-53880444 ATCTTTATTCAGAAGGTGCCTGG + Intergenic
1176280748 20:64307967-64307989 ATTGTTATTATGAAATTGGTTGG - Intergenic
1177169934 21:17643953-17643975 ACTTTTATTATGAAGGTGAAGGG - Intergenic
1181336021 22:22129591-22129613 ATTTAGATTCAGAAGATGGTGGG + Intergenic
1181367689 22:22391274-22391296 TCTTTGATTCTGAAGGTGGGTGG + Intergenic
1181373753 22:22439973-22439995 CTTTTGATGCTGAAGGTGGGTGG + Intergenic
1183425357 22:37736183-37736205 ATTCTTCATCTGAAGATGGTGGG + Intronic
1183913797 22:41100053-41100075 ATTTTTTTTCTAGAGATGGTGGG - Intronic
1184099914 22:42336585-42336607 GATTTTATTCTAAAGGTGGCGGG - Intronic
1184549383 22:45196421-45196443 ATTTGGATTCTGAGGGTAGTCGG - Exonic
949254715 3:2032103-2032125 ATTTTTATTTTGGGGGTGGGGGG - Intergenic
949794056 3:7826410-7826432 ATGTGTATTCTGCAGCTGGTGGG - Intergenic
950172580 3:10849579-10849601 ATTTTCATTCTGGAGGTGCTAGG - Intronic
950455197 3:13088643-13088665 GTTTTTATTCTGAGTGGGGTGGG - Intergenic
950528510 3:13539048-13539070 ATGTTTATTCTGAGAGCGGTGGG - Intergenic
950844705 3:16003265-16003287 ATTCTTCTTCTTAAGATGGTTGG + Intergenic
951792213 3:26498495-26498517 ATTACTACTCTGAAGTTGGTTGG + Intergenic
951867542 3:27324776-27324798 GTTTTTATTCTGAACGAGATGGG - Intronic
951890847 3:27566526-27566548 GTTTTTATTCAGAAGCTGGTTGG + Intergenic
952606593 3:35154755-35154777 ATTGTTAGTCTGAAGGTAGCAGG - Intergenic
954395558 3:50291614-50291636 ATTTTTATTCTTGAGGGGGAAGG - Intronic
955497549 3:59550704-59550726 ATTATTATTTTGAAGGTGAATGG + Intergenic
956827566 3:73012612-73012634 ATTTTCAATCTGAGGTTGGTTGG + Intronic
956890882 3:73613191-73613213 ATTTTTATTCTGAAGGTGGTGGG + Intronic
956968960 3:74499030-74499052 TATTTTTTTCTTAAGGTGGTGGG + Intronic
956975752 3:74576349-74576371 ATTTTTATTCTTAAGTGGGAAGG - Intergenic
957245372 3:77709662-77709684 ATTTTTATCCTGCAGGTGAATGG + Intergenic
958008033 3:87838283-87838305 ATGTTTATTCTGACACTGGTAGG - Intergenic
958084253 3:88785995-88786017 ATTTTTATTTTCAAGGTGCAGGG + Intergenic
958111581 3:89153808-89153830 GCTTTTATTCTGAATGTGATGGG - Intronic
958785309 3:98591697-98591719 ATTTTTTTTCTTAAGGTATTAGG + Intronic
958810001 3:98850036-98850058 ATTTTACTTCTGAGGGTTGTTGG + Intronic
959227775 3:103607721-103607743 ATCTTTCTTCACAAGGTGGTAGG - Intergenic
959372450 3:105544916-105544938 TTTTTTTTTCTTAAGGTGATAGG + Intronic
960163916 3:114380490-114380512 TTTTTTTTTCTGAAGGGGGATGG + Intronic
960198065 3:114795343-114795365 AATTTTATTCTGAATGCAGTGGG - Intronic
960575530 3:119225812-119225834 ATTTTTGTTTTTAAGGTTGTTGG - Intronic
960732389 3:120741731-120741753 AGTTTTATTCTGAAGCAGCTAGG - Intronic
961054737 3:123778612-123778634 ATTTTACTTCTGAGGGTGGCGGG - Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
962023671 3:131526235-131526257 GATTTCATTCTGAAGTTGGTGGG + Intergenic
962154712 3:132934142-132934164 ATTTTGATTCTCAAAGTTGTAGG + Intergenic
962188707 3:133287785-133287807 ATTTTTATTTTGAGAGTGTTTGG - Intronic
962216316 3:133525044-133525066 ATTTTTCTTTTTAAGATGGTTGG + Intergenic
962825626 3:139098096-139098118 ATTTTTATTCTACAGTTGTTGGG + Intronic
963085395 3:141430996-141431018 ATTTTTAATCTGAATGCTGTGGG - Intronic
963318851 3:143790344-143790366 CTTTTCTTACTGAAGGTGGTTGG - Intronic
964995483 3:162873191-162873213 TTTTTTTTTTTAAAGGTGGTAGG + Intergenic
965274214 3:166659890-166659912 ATTTTTATTCTTAATTTTGTGGG - Intergenic
965297971 3:166974622-166974644 ATGTTTATTCTGTAGTTGTTGGG - Intergenic
965492246 3:169352513-169352535 ATTTTTTTTCTGAAACTTGTTGG + Intronic
965902250 3:173656653-173656675 ATTTTAATTCAGATAGTGGTGGG - Intronic
966275809 3:178166897-178166919 CTTTTTATCCTGAAGGGTGTTGG - Intergenic
967010280 3:185426541-185426563 GATTTTATACTGAAGGTGATGGG - Intronic
967160798 3:186735949-186735971 TTCTTTATTCTGAATGTTGTAGG + Intronic
967806387 3:193717748-193717770 ATTTTTATGCTGAAGATGATGGG + Intergenic
968028132 3:195460253-195460275 ATGTTCATGTTGAAGGTGGTAGG - Intergenic
968269627 3:197393483-197393505 ATTTTTATGCTGAAGGATATAGG - Intergenic
969628292 4:8319879-8319901 ATTTTTATGCTGTATTTGGTAGG + Intergenic
969784212 4:9440663-9440685 TTTTTTATTCTGAAGCTTATAGG + Intergenic
970026528 4:11629932-11629954 GTTTTTATTCTGAATGAGCTGGG + Intergenic
971871295 4:32242690-32242712 GTTTTGATTTTGAAGGTGTTTGG - Intergenic
972128107 4:35795195-35795217 ATGTGTATTCTGAAGATGTTGGG - Intergenic
974127340 4:57712415-57712437 ATGTATATTCTGAAGCTGTTTGG - Intergenic
974501938 4:62716614-62716636 ATTTGTATTCTGCAGGCGTTGGG - Intergenic
975058688 4:69969532-69969554 AATTTTATTCTGCAGATGGAGGG + Intergenic
975263429 4:72332739-72332761 ATTTTTATGGTTAAGATGGTAGG - Intronic
976012919 4:80513772-80513794 TTTATTATTCTCAAGGTAGTTGG - Intronic
976571505 4:86617027-86617049 ATTTTTATTCTAAGTGTGATGGG + Intronic
976575615 4:86667182-86667204 ATTTATATTCTGGTGGTAGTTGG - Intronic
977387154 4:96356246-96356268 ATTATTATTATTAAGGTGATTGG - Intergenic
978126567 4:105143406-105143428 TTTTCTATTCTGCAGGTGGGAGG + Intergenic
978146830 4:105384846-105384868 TTTCTTATTCTGAATGAGGTAGG - Intronic
978203445 4:106050371-106050393 AATTTTATTCTGAAGGCATTGGG - Intronic
978336001 4:107669762-107669784 ATTTTTATCTTAAAGGTGGGTGG - Intronic
978344118 4:107748472-107748494 AGTTTTATTCTAAAGATGGAGGG + Intergenic
979176711 4:117674018-117674040 ATTTGTATTTTGAAGTTTGTAGG - Intergenic
979409029 4:120351515-120351537 GATTTTATCCTGAAGGTGATGGG + Intergenic
979795083 4:124836146-124836168 AATTTTATTATTAATGTGGTTGG + Intergenic
979880532 4:125952453-125952475 ATTTTTAATCTGATGTTGTTAGG + Intergenic
980592276 4:134905654-134905676 AGATTTTTTTTGAAGGTGGTGGG + Intergenic
981155919 4:141434841-141434863 AATTTTATCCTGAAGGTCATAGG - Intergenic
983539874 4:168897866-168897888 TTTTTTCTTCTAAAGATGGTGGG + Intronic
983632910 4:169867676-169867698 ATTTTTTTTCTGACGATTGTTGG + Intergenic
983744668 4:171182881-171182903 AATTTTATACTGAAGCTTGTGGG + Intergenic
983903934 4:173165987-173166009 TTTTTTATTCTTAAGAAGGTAGG - Intergenic
983961730 4:173762475-173762497 ACTTATATCCTGAAGGTGGGGGG + Intergenic
984240069 4:177207628-177207650 CTTTTTACTCTAAAGTTGGTTGG + Intergenic
987493161 5:18607296-18607318 ATTTTTGTTCTGATTGTTGTGGG - Intergenic
987898399 5:23979170-23979192 ATGTTTATTCTGCAGTTGTTTGG - Intronic
988418482 5:30976026-30976048 TTTTTTTTTCTGTAGATGGTAGG - Intergenic
988432850 5:31139671-31139693 AATTTTATTCTGAAAGCAGTGGG + Intergenic
990162834 5:52962114-52962136 ATTTGAATTCTGAAAGTGGCAGG + Intergenic
990311659 5:54545387-54545409 CTCTTTATTTTGATGGTGGTTGG + Intronic
990662435 5:58031501-58031523 ATTTTAATTATTAATGTGGTTGG - Intergenic
991234049 5:64373636-64373658 ATTTTTATTCAGAAGGTGTAGGG + Intergenic
992245770 5:74820796-74820818 AATTTTTTTCTGCAGGTGATGGG - Intronic
992937830 5:81728145-81728167 AGTTTTATTCTAAAGGTAATGGG + Intronic
993392486 5:87337369-87337391 ATTCTTTCTCTGAAAGTGGTAGG - Intronic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
995242215 5:109898344-109898366 ATTTTTATTGTGAACGTGTTGGG + Intergenic
995450904 5:112299493-112299515 ATGTATATTCTGAAGTTGTTGGG + Intronic
995625255 5:114069314-114069336 ATTTTTTTTCTGATGGAGGGTGG - Intergenic
995812002 5:116117833-116117855 ATTTTTATATTCAAGGAGGTTGG + Intronic
996620874 5:125501058-125501080 ATTTTTATTCTGACGTTTTTAGG + Intergenic
996864229 5:128101439-128101461 ATTTTAATTCAGAAGTTTGTAGG + Intronic
997095605 5:130907313-130907335 ACTTTGACTCTGAATGTGGTTGG - Intergenic
997355844 5:133262549-133262571 AGCTTTATGCTGAATGTGGTTGG - Intronic
997702830 5:135916363-135916385 AGTTATATGCTGAAGATGGTTGG + Intergenic
998206680 5:140162287-140162309 AATTTTATTCTGAGTGTGATGGG - Intergenic
998246636 5:140512687-140512709 CTTTTTATTCTTAAATTGGTAGG + Intronic
998850713 5:146348236-146348258 AATTCTATTCAGAAGGAGGTGGG - Intergenic
998870458 5:146546559-146546581 ATTTTTGCCCTGAAGGTTGTTGG + Intergenic
999066300 5:148689652-148689674 ATGTATATTCTGTAGTTGGTGGG - Intergenic
999068677 5:148718850-148718872 GTTTCTATTCTGAAGGAGGAAGG - Intergenic
999661873 5:153873122-153873144 ATTTCTAATATAAAGGTGGTAGG + Intergenic
999882302 5:155879398-155879420 ATTTTGGCTCTGAGGGTGGTAGG - Intronic
999928166 5:156402526-156402548 ATAATTATTCAGAAGGGGGTGGG + Intronic
1000842531 5:166238765-166238787 ATTTTTATTATGAAAGTGAGAGG - Intergenic
1000871171 5:166579296-166579318 ATTTTTGATCTGCAGCTGGTTGG + Intergenic
1001176946 5:169478779-169478801 ATTTACATTCTGAAGTTGTTGGG + Intergenic
1001506006 5:172281289-172281311 GTTTTTAATCTGAATGTGTTGGG - Intronic
1002394723 5:178943718-178943740 ATTCTTATTCTAAAGATGCTAGG - Intronic
1002732162 5:181346837-181346859 ATTGTTATTATGAAATTGGTTGG - Intergenic
1004452856 6:15763200-15763222 TTTGTTCTTCTGAATGTGGTAGG + Intergenic
1006200729 6:32287484-32287506 ATTTTTACGCTGATGGGGGTTGG + Intergenic
1007332314 6:41122361-41122383 CTTTTTACTCTGAAGGTTTTAGG + Intergenic
1008660226 6:53660258-53660280 ATTTGTATTCTGCAGTTGTTGGG + Intronic
1008757704 6:54817373-54817395 AGTTTCTATCTGAAGGTGGTAGG - Intergenic
1009992853 6:70865061-70865083 ATTTTTAATCTGAGGTTAGTTGG - Intronic
1010343193 6:74781382-74781404 CTCTTTATTCAGAAGGTGATGGG - Intergenic
1011394653 6:86893032-86893054 ATGTATATTCTGCAGGTGTTAGG - Intergenic
1011495315 6:87931610-87931632 ATTTTGATTCTAAAGATTGTGGG + Intergenic
1011593248 6:88991380-88991402 ATTTTAATGCTGAAAGAGGTTGG + Intergenic
1011965605 6:93154023-93154045 ATGTATATTCTGAAGCTGTTGGG + Intergenic
1012477830 6:99634541-99634563 ATTTTTGTTTTGAGTGTGGTGGG + Intergenic
1012513731 6:100034229-100034251 ATTTTCATTCTACATGTGGTAGG - Intergenic
1012740550 6:103011336-103011358 TTTTTTTTTCTGAAGGAGTTAGG + Intergenic
1012933006 6:105336307-105336329 ATGTGTATTCTGAAGTTGTTGGG + Intronic
1013089250 6:106884533-106884555 ATTTTTATTTTGAATGACGTGGG - Intergenic
1013467435 6:110430046-110430068 ACTTTTATTCTGAAGCTGACAGG + Intronic
1013557734 6:111273557-111273579 ATGTTTATTCTGTAGCTGTTGGG + Intergenic
1013916997 6:115352926-115352948 ATTTTTATTCAGAAAATGATGGG + Intergenic
1014421780 6:121254938-121254960 ATTATTTTTCTAAAAGTGGTGGG - Intronic
1014633751 6:123819141-123819163 ATTGTTCTTCTGGATGTGGTAGG + Intronic
1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG + Intergenic
1016206603 6:141474519-141474541 CTTTTTTTTCTGAAGGGAGTTGG + Intergenic
1016605304 6:145914914-145914936 ATATGTATTCTGAAGCTGTTGGG + Intronic
1016823822 6:148370026-148370048 ATTTTTTTTGAGGAGGTGGTTGG - Intronic
1017042761 6:150320885-150320907 CTGTTAATTCTGAAGTTGGTTGG - Intergenic
1017056712 6:150443277-150443299 ATTTTTTTTTTGAGGGTGGATGG - Intergenic
1017140131 6:151182740-151182762 ACTTATAATCTGGAGGTGGTGGG - Intergenic
1017904942 6:158751540-158751562 TTTTTTCTTTTGCAGGTGGTGGG + Intronic
1018088331 6:160324449-160324471 ATTTTGATAAAGAAGGTGGTGGG + Intergenic
1018401507 6:163425406-163425428 AATTTTATTCTGAAGGTTGTAGG + Intronic
1019236414 6:170619150-170619172 ATTGTTATTATGAAATTGGTTGG - Intergenic
1019682701 7:2360869-2360891 ATTTTTATCCTGAAGAGGATGGG + Exonic
1019837278 7:3400700-3400722 AGTTTTATTTTGTAGTTGGTGGG + Intronic
1020737343 7:11967653-11967675 TTTTTTATTCTGCAGTTGTTAGG - Intergenic
1021829702 7:24592468-24592490 ATTTTGATTCTGTAGGTGATGGG + Intronic
1022379636 7:29847757-29847779 GTTTTTACACTGAAGGCGGTGGG + Intronic
1022779831 7:33569133-33569155 ATATTTACACTGAAGGGGGTGGG + Intronic
1023331002 7:39116772-39116794 ATTTTTATTTGGAAGGAGGGAGG - Intronic
1023549245 7:41351461-41351483 ATTTTTTTTCAGAAGGTTGAAGG - Intergenic
1023632519 7:42178445-42178467 TTTGTTTTTCTGTAGGTGGTGGG - Intronic
1024290580 7:47800872-47800894 ATTTTCTTTCTGCAGCTGGTGGG - Exonic
1024559951 7:50635064-50635086 ATGTATATTCTGCAGGTGCTGGG - Intronic
1025112549 7:56231466-56231488 ATTTTTATTATGAAGGGGCCAGG + Intergenic
1026393379 7:69926124-69926146 AATTTTCTTCTGTAGTTGGTAGG + Intronic
1027366551 7:77464263-77464285 AATTTTGTTCTGAAGGCAGTGGG + Intergenic
1028325262 7:89516569-89516591 ATTTTAATTCTGATTCTGGTAGG - Intergenic
1028387526 7:90274135-90274157 ATTTTAATTGTGGAAGTGGTGGG + Intronic
1028752672 7:94398651-94398673 GTTTTTATTCTGGAGATGGAAGG + Intronic
1030098050 7:105919152-105919174 TATTTTATTCTGAAGGTGCCAGG - Intronic
1030180187 7:106699275-106699297 ATATTTAATCTGCAGGTGATTGG + Intergenic
1030510673 7:110479136-110479158 GATTTTATTCTGAATGTGCTAGG - Intergenic
1030580326 7:111347160-111347182 AATTTTGTTCTGAATGTGATGGG + Intronic
1030758738 7:113323836-113323858 ATTTTTATTTTTTAAGTGGTAGG - Intergenic
1031864470 7:127023296-127023318 AATTTTGTTCTGAGGGTTGTTGG - Intronic
1032010940 7:128347509-128347531 ATTTTAATTCCTAAGGTGATAGG - Intergenic
1032597997 7:133261573-133261595 AGTTTTATCTTGATGGTGGTTGG + Intronic
1032935858 7:136730652-136730674 ATGTGTATTCTGAAGTTGTTAGG - Intergenic
1032984056 7:137317369-137317391 ATTATGATTTTGGAGGTGGTTGG - Intronic
1033604732 7:142918554-142918576 ATTTCTATTCTGAAGGCATTGGG - Intronic
1033861498 7:145633622-145633644 TTTTTGTTTCTGAAGATGGTAGG - Intergenic
1033901883 7:146152886-146152908 ATTTTTATATTGAAGGTTGATGG - Intronic
1033946245 7:146722530-146722552 ATTTTCATTCTGTGGCTGGTTGG + Intronic
1035511356 8:187457-187479 ATTGTTATTATGAAATTGGTTGG + Intergenic
1036058595 8:5289132-5289154 ATTGTGATTGTGGAGGTGGTGGG + Intergenic
1036834827 8:12053464-12053486 TTTTTTATTCTGAAGCTTATAGG - Intergenic
1036856670 8:12300028-12300050 TTTTTTATTCTGAAGCTTATAGG - Intergenic
1037580759 8:20244842-20244864 ATTTTTTTTCTGGAGATGGGAGG - Intergenic
1037870372 8:22489001-22489023 GGTTTTATTCTGAATGTGCTAGG + Intronic
1038382087 8:27105710-27105732 ATTTTCCTTCTGAAGGTTCTAGG - Intergenic
1038828175 8:31030662-31030684 GTTTTAATTCTGGAGGGGGTGGG - Intronic
1039022633 8:33224423-33224445 ACTTTTATTCTCAATGTGATGGG + Intergenic
1039085025 8:33771425-33771447 ATTTTATTTCTAAAGGTGGGAGG + Intergenic
1040354736 8:46606457-46606479 ATTTTTATCAAAAAGGTGGTGGG + Intergenic
1040409592 8:47140582-47140604 TTGCTTATTCTGAAGGTGTTGGG - Intergenic
1040498920 8:47990600-47990622 ATTTTTATTAAGGAGGTGGGAGG + Intergenic
1040602480 8:48897937-48897959 ATTCTAATTCTGTAGGTGGACGG - Intergenic
1040699946 8:50050939-50050961 ATTTTTATCATGAAAGGGGTTGG - Intronic
1040943900 8:52861614-52861636 ATTTTTATTCAAAACATGGTTGG + Intergenic
1041010772 8:53541184-53541206 ATTTGTATTTTGTAGGTGCTTGG + Intergenic
1041749171 8:61240195-61240217 GCTTTTATTCTAATGGTGGTGGG - Intronic
1042151177 8:65786376-65786398 ATTTTAATTCTTAAGTGGGTAGG - Intronic
1042230882 8:66553233-66553255 ACTTTTATACTGAAGGAGTTTGG - Intergenic
1042417921 8:68546661-68546683 ATTTGTATTCTGTAGCTGTTTGG - Intronic
1042718289 8:71799819-71799841 ATTATTTTTCTGAAGGTTCTTGG - Intergenic
1042727822 8:71897014-71897036 ATGTTTATTCTAAAGGTCTTTGG - Intronic
1042895878 8:73667324-73667346 GATTTTATTCTGAAGGTGATTGG - Intronic
1042977738 8:74489058-74489080 ATTTTTATGCTTAAGTTTGTTGG - Intergenic
1042992797 8:74659472-74659494 ATTTTTTTGCTGAAGCTGGAGGG + Intronic
1043262079 8:78214355-78214377 ATTTTCCTCCTGAAGGTGTTAGG + Intergenic
1043277127 8:78412080-78412102 ATGGATATTTTGAAGGTGGTTGG + Intergenic
1043289478 8:78579332-78579354 ATTTTTATTTTAAAAGTGATGGG - Intronic
1043356467 8:79418599-79418621 TTCTTTATACTGAAGATGGTTGG - Intergenic
1044632227 8:94291045-94291067 TTTTATCTTCTGGAGGTGGTTGG - Intergenic
1045505619 8:102776448-102776470 ATGTTTATTCTGAAGCTGCCAGG - Intergenic
1045668425 8:104517831-104517853 ATTTTTATTTTGGAGATGGTGGG - Intronic
1045814070 8:106259255-106259277 ATGTATATTCTGAAGTTGTTGGG + Intergenic
1046229220 8:111331590-111331612 ATATTTTTTATGTAGGTGGTAGG + Intergenic
1046496182 8:115016911-115016933 ATTTATATTCTGTAGTTGTTGGG + Intergenic
1046795875 8:118371211-118371233 ACTTTTATTCTGTAGGTAATTGG + Intronic
1047055347 8:121158140-121158162 ATTTTTATTTTGGGGGTTGTAGG - Intergenic
1047382285 8:124374205-124374227 ACTACTATTCTGGAGGTGGTTGG - Intergenic
1048256528 8:132909080-132909102 AGTTTTATTCTGCATGTGATGGG + Intronic
1048495062 8:134928300-134928322 ATTCTTGTTCTGAAAGTGGGGGG + Intergenic
1050541036 9:6670410-6670432 ATTTTTGATCTGCAGTTGGTTGG + Intergenic
1050615650 9:7399155-7399177 ATTTAGATTCTGTAGGTGGTGGG + Intergenic
1050683764 9:8144287-8144309 ATTTTCATTTTGAAGCTGATTGG + Intergenic
1050782814 9:9359792-9359814 ATTTTTATTCAGCAGGTGTACGG + Intronic
1050826360 9:9951356-9951378 GTTTTAATTATGAAAGTGGTAGG + Intronic
1051078071 9:13264206-13264228 ATTTTTATTTTTAAGATGGTTGG + Intronic
1051095538 9:13461500-13461522 TTTTTTATGCTGAAAGTGTTAGG + Intergenic
1052246748 9:26346357-26346379 TTTTTTTTTCTGCAGGTGGGAGG - Intergenic
1052352979 9:27476003-27476025 GTTTTTATTCTGAGTGTGATGGG - Intronic
1053113818 9:35484871-35484893 GATTTTATTCTGAAGGCTGTTGG - Intergenic
1053393986 9:37755650-37755672 ATTACTCTTCTGATGGTGGTTGG + Intronic
1053409901 9:37909199-37909221 ATTTTTATTCAGGAGGTCTTGGG - Intronic
1053727202 9:41016174-41016196 ATTTCTATTCTGAAAGAGGATGG + Intergenic
1054701315 9:68415914-68415936 ATTTCTATTCTGAAAGAGGATGG - Intronic
1054957650 9:70931499-70931521 GTTTTTATTAGGAAGCTGGTGGG - Intronic
1055195643 9:73589736-73589758 ATTTTTATGTAGAACGTGGTAGG + Intergenic
1055546779 9:77383938-77383960 ATTGTTGTTTTGATGGTGGTGGG + Intronic
1055632443 9:78237664-78237686 ATGTTTATCCTGAAGGTTTTGGG + Intronic
1055781605 9:79827406-79827428 ATTTTTATTTTGATGGAGGAAGG + Intergenic
1055918110 9:81427726-81427748 ATATGTATACTGAAGGAGGTTGG + Intergenic
1058325375 9:103690142-103690164 ATTTTCAATCTGCAGTTGGTTGG - Intergenic
1058767465 9:108195843-108195865 AACTTTATTCTGTAGGTGATGGG + Intergenic
1059223654 9:112651194-112651216 ATTTGTATTCTGCACTTGGTTGG - Intronic
1060152778 9:121299503-121299525 ATTTTTTTGCTGGAGGTGTTAGG + Intronic
1060668114 9:125445250-125445272 AGTGTCATCCTGAAGGTGGTAGG - Intronic
1062014851 9:134286230-134286252 ATTTTTTTTTTGTAGGTTGTGGG + Intergenic
1062183140 9:135201907-135201929 ACTTTTATACTGAAGATGTTAGG - Intergenic
1186753695 X:12647943-12647965 ATTTTTATCCAGAGTGTGGTAGG - Intronic
1187030351 X:15480832-15480854 GATTTTATCCTGAAGGTGATGGG + Intronic
1188464541 X:30464868-30464890 CTTTTTTTTTTGAAGGAGGTAGG - Intergenic
1188776999 X:34231945-34231967 ATCTTTATTCTGTAGTTTGTGGG - Intergenic
1188917214 X:35926769-35926791 AAATTAATTCTGTAGGTGGTGGG - Intronic
1190230294 X:48576493-48576515 ATTTTTCTGCTCTAGGTGGTGGG + Exonic
1190388228 X:49905136-49905158 TTTTTTATTATGAAGGATGTTGG - Intergenic
1191200935 X:57780391-57780413 ATTTTTATTCTTAAGGCCCTTGG - Intergenic
1191212039 X:57895139-57895161 ATGTATATTCTGCAGGTGTTGGG - Intergenic
1191212328 X:57899748-57899770 ATTTTTATTTTCAAGATTGTTGG - Intergenic
1191611354 X:63117335-63117357 ATTTATATTCTTAAGATGTTGGG - Intergenic
1191709957 X:64139212-64139234 GATTTTATTCTGAATGTGATGGG - Intergenic
1194768387 X:97870218-97870240 AACATCATTCTGAAGGTGGTGGG + Intergenic
1195076844 X:101335537-101335559 GATTTTATTTTGAAGGTGATGGG + Intergenic
1195076931 X:101336387-101336409 GATTTTATTTTGAAGGTGATGGG - Intergenic
1195288675 X:103410292-103410314 AGTTTTATTCTCAGTGTGGTGGG + Intergenic
1195314467 X:103664615-103664637 ATTTTGATTCAGAAAATGGTGGG + Intergenic
1195447461 X:104970844-104970866 ATTTTTATTCCTCTGGTGGTAGG - Intronic
1196024371 X:111024825-111024847 ATGTATATTCTGAAGTTGTTGGG - Intronic
1196596336 X:117549966-117549988 GATTTTATTCTGAAGGTACTGGG + Intergenic
1196823047 X:119718660-119718682 ATTTTTATTTTGGGGGTGGGGGG - Intergenic
1197301997 X:124792225-124792247 ATTTTTATTCAGCATTTGGTAGG - Intronic
1197575830 X:128210204-128210226 ATTTATATTCTGCAGTTGTTTGG - Intergenic
1198326743 X:135581584-135581606 AATGTTGTTGTGAAGGTGGTGGG - Exonic
1199335294 X:146612202-146612224 ATTTTGATTTGGAAGGTGGTTGG + Intergenic
1199523662 X:148767232-148767254 GTTTTTATTGTTAATGTGGTTGG + Intronic
1199804376 X:151283221-151283243 ATCTTTATTCTGTAGGGAGTAGG - Intergenic
1200858005 Y:7960110-7960132 ACTTGTATTCAGAAGGTGATGGG - Intergenic
1201852974 Y:18508480-18508502 AATTATTTTCTGAAGGAGGTGGG + Intergenic
1201880347 Y:18811904-18811926 AATTATTTTCTGAAGGAGGTGGG - Intronic