ID: 956891912

View in Genome Browser
Species Human (GRCh38)
Location 3:73622253-73622275
Sequence TGCAGCTGACAGACAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 270}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956891907_956891912 2 Left 956891907 3:73622228-73622250 CCCAGAGCTGGCCAGCTGCTGAG 0: 1
1: 0
2: 3
3: 38
4: 326
Right 956891912 3:73622253-73622275 TGCAGCTGACAGACAGGCCAGGG 0: 1
1: 0
2: 1
3: 37
4: 270
956891906_956891912 8 Left 956891906 3:73622222-73622244 CCTTCGCCCAGAGCTGGCCAGCT 0: 1
1: 0
2: 2
3: 11
4: 204
Right 956891912 3:73622253-73622275 TGCAGCTGACAGACAGGCCAGGG 0: 1
1: 0
2: 1
3: 37
4: 270
956891908_956891912 1 Left 956891908 3:73622229-73622251 CCAGAGCTGGCCAGCTGCTGAGA 0: 1
1: 0
2: 0
3: 26
4: 250
Right 956891912 3:73622253-73622275 TGCAGCTGACAGACAGGCCAGGG 0: 1
1: 0
2: 1
3: 37
4: 270
956891905_956891912 9 Left 956891905 3:73622221-73622243 CCCTTCGCCCAGAGCTGGCCAGC 0: 1
1: 0
2: 2
3: 15
4: 168
Right 956891912 3:73622253-73622275 TGCAGCTGACAGACAGGCCAGGG 0: 1
1: 0
2: 1
3: 37
4: 270
956891909_956891912 -9 Left 956891909 3:73622239-73622261 CCAGCTGCTGAGACTGCAGCTGA 0: 1
1: 0
2: 1
3: 41
4: 397
Right 956891912 3:73622253-73622275 TGCAGCTGACAGACAGGCCAGGG 0: 1
1: 0
2: 1
3: 37
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956891912 Original CRISPR TGCAGCTGACAGACAGGCCA GGG Intronic
900567120 1:3338998-3339020 AGCAGCTGCCATTCAGGCCAAGG + Intronic
900803420 1:4751746-4751768 TGCAGTTGAAACACAAGCCAAGG + Intronic
901002060 1:6153881-6153903 TGCAGGTGACTGACAGCCCTGGG + Intronic
901030174 1:6302599-6302621 TTCAGCTGACACACAGACCATGG - Intronic
902889794 1:19434183-19434205 TGCAGCTGGCAGAAAGACCTTGG + Intronic
902936192 1:19766586-19766608 TGGAGCTGGCAGGCAGGGCACGG - Intronic
903222524 1:21876668-21876690 TGGAGCTGAAGGACAGCCCATGG + Intronic
903577499 1:24347802-24347824 GGCTGCTGTCTGACAGGCCAGGG + Intronic
904058433 1:27687393-27687415 TGCTTCTGTCAGACTGGCCAGGG - Intergenic
905130142 1:35748490-35748512 TGCAACAGACAAACAGGCCGTGG - Exonic
905249707 1:36640036-36640058 TGGGGGTGACAGAGAGGCCAGGG - Intergenic
905818669 1:40972190-40972212 TACAGCAGACATACAGGCAAAGG - Intergenic
910309942 1:85811999-85812021 TGCATTTGACAGAGAGGGCATGG - Intronic
910466425 1:87505215-87505237 TGTAGGTGAAAGAAAGGCCATGG - Intergenic
914506275 1:148292131-148292153 TGTAGGTGAAAGAAAGGCCATGG - Intergenic
915278656 1:154807466-154807488 TGCGGGTGACAGCCAGGCCCTGG + Intronic
915964687 1:160296124-160296146 AGCAGCTGTGAGATAGGCCAGGG + Exonic
916027348 1:160845013-160845035 GTCAGCTGCCAGACTGGCCACGG - Intronic
917671350 1:177276349-177276371 TGATGCTGACATCCAGGCCATGG + Exonic
917924998 1:179782095-179782117 TGCAGCTGGCAGACAGCCCTGGG + Intronic
917971361 1:180210150-180210172 TGCAGGTGAATGACATGCCAGGG + Intergenic
918572020 1:186007239-186007261 TGCAGCTGGCAAACAAGCCAAGG + Exonic
919139766 1:193556253-193556275 TGCAGCTGACCAATAGGCCATGG + Intergenic
919970806 1:202576539-202576561 GGCTGCTTACAGCCAGGCCATGG - Intronic
920389784 1:205592217-205592239 TGCTGCTGAGAAACAGGCCCAGG - Exonic
920695237 1:208176820-208176842 AGCAGCTGACAGGCAGGCTAGGG - Intronic
922400891 1:225254195-225254217 TGGAGCTGACATATAGACCATGG + Intronic
924306231 1:242691716-242691738 AGCATCTGACAGAGAGGCCCTGG + Intergenic
924936399 1:248775535-248775557 TGCAGCTTCCAGTCAGGTCACGG + Intergenic
1063043453 10:2368063-2368085 AGCAGGAGACACACAGGCCATGG - Intergenic
1063043459 10:2368104-2368126 AGCAGGAGACACACAGGCCACGG - Intergenic
1063168746 10:3487051-3487073 TGCAGCTGCTAGTGAGGCCACGG - Intergenic
1066199873 10:33134464-33134486 GCCAGCTGACACACAGCCCATGG + Intergenic
1066311642 10:34203052-34203074 TGCAGCTGGCAGTGGGGCCAGGG - Intronic
1066629000 10:37440147-37440169 TGCACCAGACAGTCTGGCCAGGG - Intergenic
1067039412 10:42941017-42941039 GGCAGCTCAAGGACAGGCCAGGG + Intergenic
1067167871 10:43879738-43879760 AGCAGCTGACTGAAAAGCCACGG + Intergenic
1067894289 10:50162525-50162547 TGGAGCTGAGAGATAGTCCAGGG + Intergenic
1067954553 10:50777736-50777758 TGGAGCTGAGAGATAGTCCAGGG - Intronic
1069582726 10:69576524-69576546 TGCAGCTGAGACAGAGGGCATGG - Intergenic
1069773763 10:70915194-70915216 TGCAGGAGATAGACAGGCCAAGG - Intergenic
1070696606 10:78568627-78568649 GGAAGCTGACAAACAAGCCAGGG - Intergenic
1070828884 10:79406767-79406789 TGCAGCAGTCAGTCAGGCCTGGG - Intronic
1071535136 10:86422292-86422314 AGAAACTGACAAACAGGCCAGGG + Intergenic
1071964536 10:90838710-90838732 AGCAGCTGGCAGAAAGGCCCTGG - Intronic
1072503453 10:96042324-96042346 TGCAACTGAGAGACAGGCCAGGG + Intergenic
1073025145 10:100482306-100482328 TGCAGCTGCCAGACACGCCGTGG - Exonic
1074890303 10:117730259-117730281 TGTAGCTCCCAGAAAGGCCAAGG + Intergenic
1075360848 10:121832328-121832350 TAAAGCTGACAGACATCCCATGG + Intronic
1075590499 10:123687842-123687864 TGCAGGGCACAGACAGGCCCTGG + Intronic
1075873617 10:125788942-125788964 TGCAGCTTACAGGAAGGCCCTGG + Exonic
1076981178 11:205671-205693 TTCAGCAGACAGAGAGGGCAGGG + Intronic
1076981196 11:205780-205802 TGCAGCAGACAGAAAGGTCCAGG + Intronic
1077202424 11:1317720-1317742 AGCAGCTGTCAGACTGGCCAGGG - Intergenic
1077340723 11:2025215-2025237 TCCAGCTGACATCCAGGCCGGGG + Intergenic
1078507803 11:11965454-11965476 AGGAGCTGGCAGAGAGGCCACGG - Intronic
1079082032 11:17420438-17420460 GACAGCTGACAGACAGGAGAAGG - Intronic
1080659546 11:34284945-34284967 GGCAGCTGATTGACTGGCCAGGG - Intronic
1081698153 11:45133045-45133067 TGCAGCTGGCAGAGAAGGCAAGG - Intronic
1082798746 11:57397958-57397980 TGCAGCTCAGAAACAGGCCTGGG - Intronic
1082815053 11:57502257-57502279 TGGAGCAGGCAGACAGACCAGGG + Intronic
1083701586 11:64482709-64482731 TGCAGCTGCCACACAAACCAAGG + Intergenic
1084020299 11:66413360-66413382 TGCAGCTGGAAGAGAGGCAAGGG + Intergenic
1085235966 11:75015790-75015812 TACAGCTGACTGACAGACTAGGG - Intronic
1085621853 11:78043754-78043776 TGCAGCTGACAGAGAAGGAAGGG + Intronic
1087789533 11:102391850-102391872 TGCTGCTGTCTGCCAGGCCAGGG - Intergenic
1088842408 11:113638169-113638191 TGCACCTGACAGCCTTGCCATGG - Intergenic
1089313303 11:117574112-117574134 TGCAGCTGCCAGAGTGGCCCAGG - Intronic
1090765141 11:129869949-129869971 TGCAGCTGATAGCCCTGCCAAGG - Exonic
1090944370 11:131416476-131416498 TGAAGGTGGCAGACAGGCTATGG - Intronic
1090954848 11:131504714-131504736 GGCAGCTGACAGACATGTGAGGG - Intronic
1091187921 11:133663180-133663202 TGAAGATGAAAGACAGGCCCTGG + Intergenic
1091287372 11:134415175-134415197 TCCTGCTGAAAGAGAGGCCAGGG - Intergenic
1202823708 11_KI270721v1_random:80404-80426 TCCAGCTGACATCCAGGCCGGGG + Intergenic
1091406185 12:210941-210963 GGCAGTTGACAAGCAGGCCAAGG - Intronic
1097692852 12:62749519-62749541 GGCAGCTGAGGGACAAGCCAGGG + Intronic
1098219062 12:68249219-68249241 TGGAGCTGCAAAACAGGCCAAGG - Intronic
1102865919 12:116373918-116373940 GGCAGCTGTGACACAGGCCAGGG + Intergenic
1103034661 12:117646850-117646872 TGCTGCTGACAGAGAGGACTTGG - Intronic
1103047963 12:117754177-117754199 TGGAGATGACAGACATGCTATGG + Intronic
1104035308 12:125093382-125093404 TGCAGCTGTGAGACAGGCTGGGG - Intronic
1104546832 12:129720949-129720971 AGGAGCTGACAGCCAGGTCATGG + Intronic
1105931677 13:25058224-25058246 TCCTGCTGAGAGACTGGCCAGGG - Intergenic
1106088856 13:26568396-26568418 TGCTGCTGACAGAGAAGCAAAGG + Intronic
1106644647 13:31619066-31619088 TGCAGGGGACACACAGGCCTGGG - Intergenic
1106994721 13:35468234-35468256 TGGAGCTCACAGCTAGGCCATGG + Intronic
1107968107 13:45615465-45615487 AGCAGATGTCAGAAAGGCCAAGG + Intronic
1110987748 13:81993328-81993350 TGCAGATGAAGTACAGGCCATGG + Intergenic
1112337115 13:98524936-98524958 AGCTGCTGACACAGAGGCCAGGG - Intronic
1113322892 13:109254159-109254181 TTCAGGTGACAGAGAGGCCCTGG - Intergenic
1113424087 13:110193650-110193672 TGCGGCTGCCAGCCAGGGCAGGG - Intronic
1113603872 13:111590855-111590877 TGGAGCAGAGAGACAGGGCAAGG - Intronic
1113678704 13:112226776-112226798 TGCAGATGACTGACACGTCAGGG - Intergenic
1113713474 13:112486973-112486995 TGAAGCTCACAGGCAGGCCTGGG + Intronic
1114551817 14:23537198-23537220 TCCAGCTGACAGAAGCGCCAAGG + Intronic
1117177680 14:53161795-53161817 TGCAGATGACAGACAGAGCTAGG + Intergenic
1117572041 14:57057415-57057437 TCCAGCTGACACTCAGCCCAAGG + Intergenic
1118259257 14:64232514-64232536 TGCAGCTGGCAGCAAGGTCAGGG + Intronic
1121105716 14:91278173-91278195 TGAAGCTCTCAGACCGGCCATGG + Exonic
1122189251 14:100026958-100026980 TGCAGAGGGCAGACAGACCAGGG + Intronic
1122898021 14:104769952-104769974 AGCTGGTGACAGACAGCCCAGGG + Exonic
1122938376 14:104970308-104970330 TGCAGCTGACAGACGGGCAGGGG - Intronic
1123052129 14:105549636-105549658 TGCAGCTGAGAGCAAGGCAACGG - Intergenic
1124193157 15:27597910-27597932 AACACCTGACAGACAGGACAAGG + Intergenic
1124197860 15:27648507-27648529 TGCAGCTGTCACTCAGGCCTCGG - Intergenic
1124436142 15:29651446-29651468 TGCAGCAGACAGGCAGGCCTGGG + Intergenic
1125985724 15:44049655-44049677 TGGAGATGACAGAAAGGACAAGG - Intronic
1128082190 15:64863349-64863371 CTCAGCTGACAGACAGGCACAGG - Intronic
1128186097 15:65644588-65644610 GGCAGCAGCCAGCCAGGCCAGGG + Intronic
1128536298 15:68493174-68493196 TGCTGCTGACAGACTGGGAAGGG + Intergenic
1129385159 15:75192319-75192341 TGGAGCTGACACACGGGCCCCGG + Intergenic
1129549486 15:76432245-76432267 AGCAACTGAGAGAAAGGCCAGGG + Intronic
1130306548 15:82715483-82715505 TGCTGCTGTCAGACTGGCCTGGG - Intergenic
1130412088 15:83655439-83655461 TGCTGCTGACAGATAGGCTTGGG + Intronic
1130684345 15:86023857-86023879 AGCAGTAGACAGACAGGGCAGGG - Intergenic
1131409012 15:92190201-92190223 TGCAGCTTAGAGGCAGCCCAGGG - Intergenic
1132502279 16:289861-289883 TGCACCTGGCAGCCAGGCCCTGG - Intronic
1132533684 16:466819-466841 AGCAGCTGACAGATGGGCCTGGG + Intronic
1132679274 16:1133090-1133112 TGCTGCTGGGAGACAGACCAGGG + Intergenic
1133554916 16:6896956-6896978 TGCAGCTGACAGGCCGTCTAAGG + Intronic
1133724056 16:8521074-8521096 TGCTGGTGTCTGACAGGCCAAGG - Intergenic
1134129623 16:11640478-11640500 TGCAGCAGAGAGGCAGCCCAAGG + Intergenic
1134378782 16:13704475-13704497 CGCAGGTGTCAGACAGGCCAAGG + Intergenic
1136136303 16:28258811-28258833 TGCAGCTGAAAGACGGGCAAGGG - Intergenic
1136279940 16:29202460-29202482 GGCAGGTGACAGGGAGGCCACGG - Intergenic
1140627248 16:76809008-76809030 CGCAGCTGATAAACAGACCATGG + Intergenic
1140905784 16:79407898-79407920 TGCAGCTGACAGACAAGGAAAGG + Intergenic
1141397438 16:83717476-83717498 GGCAGCTGAGAAACAGGCCCAGG + Intronic
1141600867 16:85125517-85125539 TTCAGCAGACAGAAGGGCCAGGG + Intergenic
1142034740 16:87856014-87856036 TCCCACTTACAGACAGGCCAAGG - Intronic
1142084302 16:88168398-88168420 GGCAGGTGACAGGGAGGCCACGG - Intergenic
1142740509 17:1929255-1929277 TGCAGCTGACATACCAGCCAAGG - Intergenic
1144470157 17:15532344-15532366 GGGAGCTGCCAGACAGGTCAAGG + Intronic
1144926184 17:18811305-18811327 GGGAGCTGCCAGACAGGTCAAGG - Intergenic
1147675509 17:42202471-42202493 TTCAGCTGCCAGGGAGGCCAGGG + Intronic
1148206207 17:45781811-45781833 TCCCGCTGACGGACAGGTCAGGG - Intergenic
1148941305 17:51214439-51214461 AGAAGCTTACAGACAGACCATGG + Intronic
1151371643 17:73650336-73650358 TGCAACTGCCAGACAGGAGAGGG + Intergenic
1151837014 17:76588377-76588399 TGCAGCACTCAGCCAGGCCAGGG - Intergenic
1152545641 17:80998912-80998934 TGGGGCTGACAGACAGGGCCAGG - Intronic
1152684776 17:81688583-81688605 TGGGGCTGACACAGAGGCCAGGG - Intronic
1153673191 18:7432187-7432209 AGCAGCTCTCAGGCAGGCCAAGG + Intergenic
1157211729 18:45748570-45748592 TGATGCTGAAAGAAAGGCCAGGG - Intronic
1160708952 19:541963-541985 TGGAGCTGACAGGCAGGACCGGG - Exonic
1161515436 19:4693675-4693697 TGCAGCTTGCACACAGGCCCAGG - Intronic
1163325105 19:16598473-16598495 TGCATCTGGGAGGCAGGCCAGGG - Intronic
1165031637 19:33002082-33002104 GGCAGCTGCCGCACAGGCCATGG - Intronic
1165139716 19:33691292-33691314 TGCAGCTGGCAGACCTGGCAAGG + Intronic
1165219143 19:34300631-34300653 TGCAGCGGTCAGACTGCCCAGGG - Exonic
1165663308 19:37602148-37602170 TAGAGCTAACAGACATGCCATGG + Intronic
1165740668 19:38203470-38203492 TGCAGCGGCCAGGCAGGCCCAGG + Intronic
1166857169 19:45788184-45788206 TGCAGAGGACAGACAGGCCCAGG - Intronic
1168146865 19:54424499-54424521 TGCAAGAGACAGACAGGCCTGGG + Intronic
1168326155 19:55539516-55539538 GGCACCTGCCAGACAGGACACGG - Intergenic
925194217 2:1910304-1910326 TGCAGCAGAGAAACTGGCCAAGG - Exonic
925483212 2:4299779-4299801 TGCAGTTGAACCACAGGCCAGGG + Intergenic
925517445 2:4699138-4699160 TGCAGTTGACATCCAGGTCACGG + Intergenic
925853743 2:8109494-8109516 TGCTGCTGACAGCCAGGGAAAGG - Intergenic
925990284 2:9249303-9249325 TGGGGCAGACAGACAGGCCACGG - Intronic
927381654 2:22486440-22486462 TTCAGGAGACAGAGAGGCCAGGG + Intergenic
930558050 2:52924556-52924578 TGCAGCTGCTAGACAGACTATGG - Intergenic
933041141 2:77468563-77468585 TGGAGCAGACAGACATGTCAAGG + Intronic
934520506 2:95017360-95017382 TGAAGCTGTGAGACAGGGCATGG + Intergenic
936154537 2:110039656-110039678 TGCAGCTCCCAGGCAGGCAACGG - Intergenic
936190146 2:110331758-110331780 TGCAGCTCCCAGGCAGGCAACGG + Intergenic
936238715 2:110768891-110768913 GGCAGCTGACAGACAGGTCTCGG + Intronic
937436733 2:121887544-121887566 TTCAGCAGACAGACAAGCAAAGG + Intergenic
940849472 2:158674271-158674293 TGCAGTTGACAGACTGGACAGGG + Intronic
941236353 2:162979768-162979790 TGGAGATGGCAGACATGCCATGG - Intergenic
942596653 2:177597838-177597860 TGGTGCTGACAGCCAGGCCATGG - Intergenic
942905213 2:181172854-181172876 TGCACATAACAGAAAGGCCAAGG + Intergenic
943328364 2:186528605-186528627 TGCAGCTGGCAGGCCGGGCATGG + Intergenic
944456788 2:199903283-199903305 TTCAGCTGACAGAATGGCCAGGG - Intergenic
944591854 2:201225271-201225293 TGGAACTGACAGAAAGGCAAGGG - Intronic
947447703 2:230177134-230177156 TGCAGCGGAGAGACAGACCACGG + Intronic
947536853 2:230945136-230945158 TACAGAAGACAGACAGGCTAAGG + Intronic
947932596 2:233975993-233976015 TGCAGCTTCCATCCAGGCCAAGG - Intronic
948006830 2:234616644-234616666 TGCAGCTTAGAAACAAGCCATGG + Intergenic
948463281 2:238140380-238140402 TGCAGATGACACCCAGGGCATGG + Intronic
948755132 2:240155094-240155116 TGAGGCTTACAGGCAGGCCAGGG + Intergenic
1168848650 20:961735-961757 AGCAGCTGGCAGGCAGGCCTAGG - Intronic
1170304030 20:14917865-14917887 TGAAGATGACAGACAGGTAAAGG + Intronic
1171163275 20:22947854-22947876 TCCAGCTTACAGACAGCCTATGG + Intergenic
1171384583 20:24761653-24761675 TGCAGCTGACAGTCTAGGCAAGG - Intergenic
1172117310 20:32580826-32580848 AGGAACTGACAGACAGCCCAGGG + Intronic
1172574259 20:35995161-35995183 CCCTGCTGTCAGACAGGCCAAGG - Intronic
1172760334 20:37316974-37316996 GCCAGCAGACAGCCAGGCCAGGG + Exonic
1173243349 20:41317319-41317341 GGCGGCTGACAGAAAGACCAGGG + Intronic
1173368141 20:42407228-42407250 TGCAGCTGATTGAGGGGCCACGG + Intronic
1174359630 20:50019988-50020010 GCCAGCTCACAGACAGGCCTGGG + Intergenic
1174407688 20:50312779-50312801 GGGTGCTGACAGACATGCCAAGG - Intergenic
1174413253 20:50349635-50349657 TTCATCTGAGAGCCAGGCCAGGG - Intergenic
1175226637 20:57448323-57448345 GGCAGCTGCCAGCCAGGCCGAGG - Intergenic
1177846108 21:26289148-26289170 AGCAGCTTAAAAACAGGCCAAGG - Intergenic
1180005733 21:45019546-45019568 TGCAGGGGGCGGACAGGCCAAGG + Intergenic
1180183168 21:46126979-46127001 TGCAGCTCCGAGGCAGGCCAGGG - Intronic
1181661007 22:24348736-24348758 TGCAGTTAACAGCCAGGCCATGG - Intronic
1182506717 22:30788468-30788490 GGCAGCTGACAGACCAGCCAAGG + Intronic
1183276732 22:36903002-36903024 TGCAGGTGGCCCACAGGCCAAGG - Intergenic
1183599566 22:38832155-38832177 TGCAGCGGCCAGGAAGGCCATGG + Intronic
949841764 3:8327600-8327622 AGCAGCTGAAAGACAGGTAAGGG - Intergenic
950966775 3:17152184-17152206 TGCAGGTGACAGCCAGACCCAGG + Intergenic
953041098 3:39255586-39255608 TCAAGGTGAAAGACAGGCCAGGG + Intergenic
953139171 3:40211488-40211510 TCCAACTCACAGACAAGCCAGGG - Intronic
953668298 3:44941850-44941872 TGCAAGTGGCACACAGGCCATGG + Intronic
954072262 3:48151552-48151574 TGCAGCTGGAAGCCAGGGCAGGG + Intergenic
954756358 3:52842524-52842546 TGGAGATGACAGACAGGAGAGGG - Intronic
954952718 3:54489357-54489379 TGGAGCTGACTGACAGGCAGAGG - Intronic
956574517 3:70737158-70737180 TGCAGGGGAGAGACAGGCCAGGG + Intergenic
956891912 3:73622253-73622275 TGCAGCTGACAGACAGGCCAGGG + Intronic
957587064 3:82146239-82146261 TCCAGCTTGCAGACAGCCCATGG + Intergenic
959426232 3:106192458-106192480 TGCTGATGGCAGACAGGCTAGGG - Intergenic
961386812 3:126527422-126527444 TGCAGCTGAGAGTGAGGCTATGG - Intronic
962110515 3:132441215-132441237 TGCAGCTGAAAGACAGAACTTGG + Intronic
962421042 3:135229553-135229575 AGCAGCTGACAGACTGTCTATGG - Intronic
962649411 3:137473523-137473545 TACAGATACCAGACAGGCCAGGG + Intergenic
962935741 3:140079025-140079047 TGCAGCTAACAGACAGAACTAGG - Intronic
963940571 3:151092347-151092369 TCCAGCTGGAAGGCAGGCCATGG - Intronic
965165385 3:165189654-165189676 TGCAGTTGACAGTCAAGCCAAGG + Exonic
966620204 3:181955118-181955140 TGCATCTGACATTCAGGCAATGG - Intergenic
967241653 3:187445449-187445471 TGCAGCAATCAGACAGGCCCTGG - Intergenic
968654697 4:1773431-1773453 GGCAGCTCACAGACAGCCCCTGG - Intergenic
969318788 4:6397650-6397672 TGCAGCTGCCAGACCTACCAGGG + Intronic
970457131 4:16235934-16235956 TCCAGTTGAAAGACAGGGCATGG + Intergenic
972277782 4:37573426-37573448 TGCAGCTGAGAGTCAGGGGATGG - Intronic
973729450 4:53809765-53809787 TGGAGCTGAGACACAAGCCATGG - Intronic
976857778 4:89625528-89625550 TTTAGCTGACTGAAAGGCCAGGG - Intergenic
979555998 4:122048196-122048218 TGCAGCTGACACACTGTCAAAGG - Intergenic
981011809 4:139933028-139933050 CACAGCAGACAGACAGGCCAAGG + Intronic
983656335 4:170089215-170089237 TGAAGCTCACAGACAGGTCGGGG - Intronic
983775522 4:171601986-171602008 TCCAGAGGACAGACAGGCCATGG - Intergenic
984373591 4:178898799-178898821 TTCAGGTGAAAGACAGGCCATGG + Intergenic
985091372 4:186365797-186365819 GGCAGCTGGCAGACAGCCCATGG + Intergenic
985651345 5:1109167-1109189 TGCACCTTCCAGACAGGCCGGGG + Intronic
985949847 5:3214922-3214944 TGCAGCCAACAGAAGGGCCACGG + Intergenic
988197321 5:28021180-28021202 TGCTGCTGAAAGACAGTCCTTGG + Intergenic
995468994 5:112480350-112480372 TGCAGCTGACAGGTAGACCAAGG - Intergenic
997372127 5:133368771-133368793 TACATCTGACAGCAAGGCCAAGG - Intronic
998180068 5:139930796-139930818 TAAAGCAGACAGGCAGGCCATGG + Intronic
999622413 5:153486568-153486590 TTGATCTGACTGACAGGCCACGG - Intergenic
1000369270 5:160519421-160519443 CACAGCTGACAGACTGGCCATGG - Intergenic
1001702514 5:173717646-173717668 CCCAGCTGACAGACAAGCAAAGG + Intergenic
1001754995 5:174161433-174161455 TACAGCTGAGAAACAGGCCCAGG + Intronic
1002442153 5:179270075-179270097 AGCATTTCACAGACAGGCCAGGG - Intronic
1004644695 6:17549073-17549095 TGAAGCTGAAAGACAAGCCATGG + Intronic
1005992301 6:30910885-30910907 TGCAGCTGTCAGCCAGGACTTGG + Exonic
1006220338 6:32484373-32484395 TGCTCCTGACAGCCAGGCCCGGG + Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1008467150 6:51843357-51843379 TTCAGCTGTCAGTCAGGCCCAGG - Intronic
1008792910 6:55260705-55260727 TGCATCTGAAAGACAGCCTATGG + Intronic
1009338920 6:62529398-62529420 TGCTGCTGGCAAACTGGCCATGG - Intergenic
1010197559 6:73255051-73255073 TATAGCTGACAGACAGGACTTGG + Intronic
1011536384 6:88380607-88380629 TGCAATTGAGAGACAGGCCTGGG + Intergenic
1011768973 6:90654730-90654752 AGCAGCTGAAACACAAGCCATGG - Intergenic
1011904296 6:92342692-92342714 TGCAGGTTACAGACTGTCCAGGG + Intergenic
1015200768 6:130577654-130577676 TGCAGCTCTCAGAAAGTCCACGG + Intergenic
1017377696 6:153790071-153790093 TGCAGGTGACAAACAGTGCAAGG + Intergenic
1017802088 6:157906017-157906039 TGCACCCGAAAGACAGGACAAGG + Intronic
1017876835 6:158531763-158531785 TTCAGCTGAGAGCCAGGCCGAGG + Intergenic
1018949517 6:168370281-168370303 AGGAGCTGACAGACAGGAGAGGG + Intergenic
1019385742 7:755105-755127 TGCACCAGACAGACAGGGCCCGG + Intronic
1019416596 7:930341-930363 TGCAGCAGAAAGGCAGGCAAAGG + Intronic
1019492061 7:1318908-1318930 GGCAGCCCCCAGACAGGCCATGG + Intergenic
1019870752 7:3758664-3758686 TGCAGGTGACACACAGAACAAGG - Intronic
1019954721 7:4404614-4404636 TGCAGGTGCCAGCCAGGCCCTGG - Intergenic
1021482029 7:21128764-21128786 TGCTGCTGCCAGTCAGCCCAGGG + Intergenic
1021922090 7:25495611-25495633 AGCAGTTGGCAGGCAGGCCACGG + Intergenic
1022397458 7:30002291-30002313 AGAAGCTGACAGAGAAGCCAGGG + Intergenic
1022515829 7:30974539-30974561 TGGAGTGGACAGTCAGGCCATGG + Intronic
1022650221 7:32267296-32267318 TGGAGCTGTCCCACAGGCCATGG + Intronic
1022652502 7:32290114-32290136 TGCTGCTGGCAGACAGGCACTGG - Intronic
1023131526 7:37007880-37007902 TGAAGCTCACAGCCTGGCCAGGG + Intronic
1023233068 7:38054033-38054055 TGAAATTGACAGACAGTCCATGG + Intergenic
1024245470 7:47466574-47466596 TGCAACTGACAGGAAGTCCAGGG - Intronic
1025257241 7:57392940-57392962 TTCATCTGAGAGCCAGGCCAGGG + Intergenic
1026943568 7:74302586-74302608 TGCAGCTGGGAGACAAGCAAGGG - Intronic
1028253747 7:88566530-88566552 TGAAGCCAACAGACAGGCCAGGG + Intergenic
1033563512 7:142556942-142556964 GGAAGCTGACTCACAGGCCACGG - Intergenic
1033658595 7:143389058-143389080 TGCTGTTTACAGACAGGACATGG - Intronic
1034399400 7:150852167-150852189 TGAAGCTGACAGATGGACCAGGG - Intronic
1034813354 7:154151299-154151321 CGCAGCTCAGAGACAAGCCAGGG - Intronic
1035227258 7:157440551-157440573 AGCTGCTGACAGTCAAGCCACGG - Intergenic
1036773357 8:11593531-11593553 TGCAGCTGCGACACAGGCCCCGG - Intergenic
1037328332 8:17717738-17717760 TGCATGTGACAGAGAGGCAAGGG - Intronic
1037662454 8:20939530-20939552 AGCAGGTGCCAGGCAGGCCAGGG + Intergenic
1040509209 8:48078647-48078669 TCCAGCTTACAGACAGCACATGG - Intergenic
1041196449 8:55406501-55406523 TGCAACTGCCAGAAAGGCCCGGG + Intronic
1042340230 8:67671111-67671133 TGCAGTTGACAGGGAGCCCAGGG + Intronic
1042472196 8:69203543-69203565 TGCAGCATACAGAGAGGCTAAGG - Intergenic
1045087626 8:98703650-98703672 TGCTGCTGAGAGACAGTTCAAGG - Intronic
1047886023 8:129251008-129251030 TGCAGCTGTCAGAGGTGCCAGGG + Intergenic
1049300531 8:141867195-141867217 AGCAGCTGAGAGACAGGCTGGGG + Intergenic
1049526444 8:143129080-143129102 TGCAGCTTCCAGACAGCCCCAGG + Intergenic
1049855275 8:144857757-144857779 GGCAGCTGCCAGACAGGCCCTGG - Intergenic
1053366349 9:37525060-37525082 GGCACCTGGCAGCCAGGCCAAGG - Intronic
1055511909 9:77003527-77003549 AGCAGCTGACTGACTGCCCAGGG + Intergenic
1055621327 9:78127822-78127844 TGCAGGGGGCAGACAGGCCACGG + Intergenic
1056795879 9:89658618-89658640 TGGAGTTGGCAGAGAGGCCACGG - Intergenic
1057442265 9:95091108-95091130 AGCAGCTGAAAGCAAGGCCAAGG + Intergenic
1059334001 9:113557312-113557334 TGCTGCTGCCAGAAGGGCCAGGG + Intronic
1059353714 9:113684027-113684049 TGCAGGTGGGAGACAGGTCAGGG + Intergenic
1060736663 9:126070536-126070558 GCCAGCAGACAGACAGGCCAGGG - Intergenic
1060762959 9:126271438-126271460 GGGAGCAGACAGAGAGGCCAGGG + Intergenic
1060785005 9:126444491-126444513 TGCTGCGGACAGACAGGCAAAGG - Intronic
1061213020 9:129204281-129204303 TGCTGCTGACAGTGAGGCCTGGG - Intergenic
1061930951 9:133832926-133832948 TGCAGGTCACAGCCAGGCCTGGG - Intronic
1185822245 X:3216803-3216825 CGCAGCTGAGAGGCAGGCTATGG + Intergenic
1199978004 X:152905694-152905716 TGAAGCTGTCAGACAGGCTTGGG + Intergenic
1201256713 Y:12114728-12114750 TGCAGCTGAGATGCAGGCTATGG - Intergenic