ID: 956893199

View in Genome Browser
Species Human (GRCh38)
Location 3:73633201-73633223
Sequence AGGACACGATTTCAAAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956893199_956893201 -7 Left 956893199 3:73633201-73633223 CCTGTTCTTTGAAATCGTGTCCT No data
Right 956893201 3:73633217-73633239 GTGTCCTGAGACTGTGGTTTTGG No data
956893199_956893203 10 Left 956893199 3:73633201-73633223 CCTGTTCTTTGAAATCGTGTCCT No data
Right 956893203 3:73633234-73633256 TTTTGGTACCCAGATCAAACTGG No data
956893199_956893204 17 Left 956893199 3:73633201-73633223 CCTGTTCTTTGAAATCGTGTCCT No data
Right 956893204 3:73633241-73633263 ACCCAGATCAAACTGGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956893199 Original CRISPR AGGACACGATTTCAAAGAAC AGG (reversed) Intergenic
No off target data available for this crispr