ID: 956896065

View in Genome Browser
Species Human (GRCh38)
Location 3:73661184-73661206
Sequence ACTATCAAACAGCCTCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956896065_956896068 3 Left 956896065 3:73661184-73661206 CCTACCTGAGGCTGTTTGATAGT No data
Right 956896068 3:73661210-73661232 CTTTAAAAAATGGAAGTAGAAGG No data
956896065_956896067 -7 Left 956896065 3:73661184-73661206 CCTACCTGAGGCTGTTTGATAGT No data
Right 956896067 3:73661200-73661222 TGATAGTTAACTTTAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956896065 Original CRISPR ACTATCAAACAGCCTCAGGT AGG (reversed) Intergenic
No off target data available for this crispr