ID: 956901427

View in Genome Browser
Species Human (GRCh38)
Location 3:73720174-73720196
Sequence ATGTACTCATGAGCTCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956901427_956901430 -1 Left 956901427 3:73720174-73720196 CCTAGCAGAGCTCATGAGTACAT No data
Right 956901430 3:73720196-73720218 TCCTTACTGTGGAGAAATAAGGG No data
956901427_956901429 -2 Left 956901427 3:73720174-73720196 CCTAGCAGAGCTCATGAGTACAT No data
Right 956901429 3:73720195-73720217 ATCCTTACTGTGGAGAAATAAGG No data
956901427_956901432 0 Left 956901427 3:73720174-73720196 CCTAGCAGAGCTCATGAGTACAT No data
Right 956901432 3:73720197-73720219 CCTTACTGTGGAGAAATAAGGGG No data
956901427_956901434 10 Left 956901427 3:73720174-73720196 CCTAGCAGAGCTCATGAGTACAT No data
Right 956901434 3:73720207-73720229 GAGAAATAAGGGGTTTTCCAGGG No data
956901427_956901433 9 Left 956901427 3:73720174-73720196 CCTAGCAGAGCTCATGAGTACAT No data
Right 956901433 3:73720206-73720228 GGAGAAATAAGGGGTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956901427 Original CRISPR ATGTACTCATGAGCTCTGCT AGG (reversed) Intergenic
No off target data available for this crispr