ID: 956901963

View in Genome Browser
Species Human (GRCh38)
Location 3:73726225-73726247
Sequence AAACTGGGGCTCTGTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956901953_956901963 6 Left 956901953 3:73726196-73726218 CCTCCAGGGGAGGGATGGATGCT No data
Right 956901963 3:73726225-73726247 AAACTGGGGCTCTGTGAGGGAGG No data
956901951_956901963 14 Left 956901951 3:73726188-73726210 CCATTGAGCCTCCAGGGGAGGGA No data
Right 956901963 3:73726225-73726247 AAACTGGGGCTCTGTGAGGGAGG No data
956901955_956901963 3 Left 956901955 3:73726199-73726221 CCAGGGGAGGGATGGATGCTGGA No data
Right 956901963 3:73726225-73726247 AAACTGGGGCTCTGTGAGGGAGG No data
956901945_956901963 23 Left 956901945 3:73726179-73726201 CCTCAGAGACCATTGAGCCTCCA No data
Right 956901963 3:73726225-73726247 AAACTGGGGCTCTGTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956901963 Original CRISPR AAACTGGGGCTCTGTGAGGG AGG Intergenic
No off target data available for this crispr