ID: 956906999

View in Genome Browser
Species Human (GRCh38)
Location 3:73776803-73776825
Sequence GAAGCCATGACAGCTAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956906994_956906999 11 Left 956906994 3:73776769-73776791 CCATAACCTTTTTCTCCTTCCAG No data
Right 956906999 3:73776803-73776825 GAAGCCATGACAGCTAGAGCTGG No data
956906996_956906999 -4 Left 956906996 3:73776784-73776806 CCTTCCAGTTGCCTAGAATGAAG No data
Right 956906999 3:73776803-73776825 GAAGCCATGACAGCTAGAGCTGG No data
956906997_956906999 -8 Left 956906997 3:73776788-73776810 CCAGTTGCCTAGAATGAAGCCAT No data
Right 956906999 3:73776803-73776825 GAAGCCATGACAGCTAGAGCTGG No data
956906995_956906999 5 Left 956906995 3:73776775-73776797 CCTTTTTCTCCTTCCAGTTGCCT No data
Right 956906999 3:73776803-73776825 GAAGCCATGACAGCTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956906999 Original CRISPR GAAGCCATGACAGCTAGAGC TGG Intergenic