ID: 956907039

View in Genome Browser
Species Human (GRCh38)
Location 3:73777231-73777253
Sequence CAGATTATGCAGAAGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956907035_956907039 6 Left 956907035 3:73777202-73777224 CCTCAGAATCTGCATTTGCTATT No data
Right 956907039 3:73777231-73777253 CAGATTATGCAGAAGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956907039 Original CRISPR CAGATTATGCAGAAGGTGGT TGG Intergenic
No off target data available for this crispr