ID: 956915085

View in Genome Browser
Species Human (GRCh38)
Location 3:73862429-73862451
Sequence TCTGCTCCCCAATGCTCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956915085_956915088 -4 Left 956915085 3:73862429-73862451 CCTCCGGAGCATTGGGGAGCAGA No data
Right 956915088 3:73862448-73862470 CAGAGTTTTTAAGGACAACTTGG 0: 88
1: 203
2: 249
3: 324
4: 509
956915085_956915091 6 Left 956915085 3:73862429-73862451 CCTCCGGAGCATTGGGGAGCAGA No data
Right 956915091 3:73862458-73862480 AAGGACAACTTGGTGGGTAGCGG 0: 11
1: 76
2: 282
3: 444
4: 622
956915085_956915092 7 Left 956915085 3:73862429-73862451 CCTCCGGAGCATTGGGGAGCAGA No data
Right 956915092 3:73862459-73862481 AGGACAACTTGGTGGGTAGCGGG No data
956915085_956915089 -1 Left 956915085 3:73862429-73862451 CCTCCGGAGCATTGGGGAGCAGA No data
Right 956915089 3:73862451-73862473 AGTTTTTAAGGACAACTTGGTGG 0: 94
1: 199
2: 278
3: 382
4: 522
956915085_956915090 0 Left 956915085 3:73862429-73862451 CCTCCGGAGCATTGGGGAGCAGA No data
Right 956915090 3:73862452-73862474 GTTTTTAAGGACAACTTGGTGGG 0: 92
1: 198
2: 331
3: 403
4: 604
956915085_956915093 23 Left 956915085 3:73862429-73862451 CCTCCGGAGCATTGGGGAGCAGA No data
Right 956915093 3:73862475-73862497 TAGCGGGAAGCCAGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956915085 Original CRISPR TCTGCTCCCCAATGCTCCGG AGG (reversed) Intergenic
No off target data available for this crispr