ID: 956916882

View in Genome Browser
Species Human (GRCh38)
Location 3:73881039-73881061
Sequence AAGCAGCAGTAGAAACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956916877_956916882 1 Left 956916877 3:73881015-73881037 CCAGCAGGCTCCTCAGCTAAAGG No data
Right 956916882 3:73881039-73881061 AAGCAGCAGTAGAAACAGGAAGG No data
956916880_956916882 -9 Left 956916880 3:73881025-73881047 CCTCAGCTAAAGGGAAGCAGCAG No data
Right 956916882 3:73881039-73881061 AAGCAGCAGTAGAAACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956916882 Original CRISPR AAGCAGCAGTAGAAACAGGA AGG Intergenic
No off target data available for this crispr