ID: 956916912

View in Genome Browser
Species Human (GRCh38)
Location 3:73881245-73881267
Sequence TAGAATCTTCAAAGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956916912_956916919 13 Left 956916912 3:73881245-73881267 CCATGCTCCCTTTGAAGATTCTA No data
Right 956916919 3:73881281-73881303 TCTTGCCTTTTTCAAGCTTCCGG No data
956916912_956916921 23 Left 956916912 3:73881245-73881267 CCATGCTCCCTTTGAAGATTCTA No data
Right 956916921 3:73881291-73881313 TTCAAGCTTCCGGTAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956916912 Original CRISPR TAGAATCTTCAAAGGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr