ID: 956920139

View in Genome Browser
Species Human (GRCh38)
Location 3:73919422-73919444
Sequence ACCGCCCAGCCCTTTCTTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956920139_956920144 16 Left 956920139 3:73919422-73919444 CCGTCAAGAAAGGGCTGGGCGGT No data
Right 956920144 3:73919461-73919483 GTACATTACATACAGTCATTAGG No data
956920139_956920140 -9 Left 956920139 3:73919422-73919444 CCGTCAAGAAAGGGCTGGGCGGT No data
Right 956920140 3:73919436-73919458 CTGGGCGGTGTTGCTCCACCTGG No data
956920139_956920141 -8 Left 956920139 3:73919422-73919444 CCGTCAAGAAAGGGCTGGGCGGT No data
Right 956920141 3:73919437-73919459 TGGGCGGTGTTGCTCCACCTGGG No data
956920139_956920146 18 Left 956920139 3:73919422-73919444 CCGTCAAGAAAGGGCTGGGCGGT No data
Right 956920146 3:73919463-73919485 ACATTACATACAGTCATTAGGGG No data
956920139_956920145 17 Left 956920139 3:73919422-73919444 CCGTCAAGAAAGGGCTGGGCGGT No data
Right 956920145 3:73919462-73919484 TACATTACATACAGTCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956920139 Original CRISPR ACCGCCCAGCCCTTTCTTGA CGG (reversed) Intergenic
No off target data available for this crispr