ID: 956924265

View in Genome Browser
Species Human (GRCh38)
Location 3:73966757-73966779
Sequence CATCAGCCAGTTCTAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956924265_956924266 20 Left 956924265 3:73966757-73966779 CCAGTTTCTAGAACTGGCTGATG No data
Right 956924266 3:73966800-73966822 TCATTAATGACAAGTGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956924265 Original CRISPR CATCAGCCAGTTCTAGAAAC TGG (reversed) Intergenic
No off target data available for this crispr