ID: 956924666

View in Genome Browser
Species Human (GRCh38)
Location 3:73970881-73970903
Sequence GCCACTTAGAAAACAAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956924666_956924673 9 Left 956924666 3:73970881-73970903 CCCTGGTTTGTTTTCTAAGTGGC No data
Right 956924673 3:73970913-73970935 ATATTTGGACATGGAATTTTGGG No data
956924666_956924671 0 Left 956924666 3:73970881-73970903 CCCTGGTTTGTTTTCTAAGTGGC No data
Right 956924671 3:73970904-73970926 TAGGGATCAATATTTGGACATGG No data
956924666_956924672 8 Left 956924666 3:73970881-73970903 CCCTGGTTTGTTTTCTAAGTGGC No data
Right 956924672 3:73970912-73970934 AATATTTGGACATGGAATTTTGG No data
956924666_956924675 24 Left 956924666 3:73970881-73970903 CCCTGGTTTGTTTTCTAAGTGGC No data
Right 956924675 3:73970928-73970950 ATTTTGGGGCTCTGTGTCCCTGG No data
956924666_956924674 10 Left 956924666 3:73970881-73970903 CCCTGGTTTGTTTTCTAAGTGGC No data
Right 956924674 3:73970914-73970936 TATTTGGACATGGAATTTTGGGG No data
956924666_956924670 -6 Left 956924666 3:73970881-73970903 CCCTGGTTTGTTTTCTAAGTGGC No data
Right 956924670 3:73970898-73970920 AGTGGCTAGGGATCAATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956924666 Original CRISPR GCCACTTAGAAAACAAACCA GGG (reversed) Intergenic
No off target data available for this crispr