ID: 956926188

View in Genome Browser
Species Human (GRCh38)
Location 3:73991302-73991324
Sequence ACAGGGACATTTAATTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956926188_956926191 2 Left 956926188 3:73991302-73991324 CCTGCAGAATTAAATGTCCCTGT No data
Right 956926191 3:73991327-73991349 GACAGCTTTGAAGAGAGTAGTGG 0: 1508
1: 3386
2: 1535
3: 836
4: 800

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956926188 Original CRISPR ACAGGGACATTTAATTCTGC AGG (reversed) Intergenic
No off target data available for this crispr